Example usage for java.lang RuntimeException RuntimeException

Introduction

In this page you can find the example usage for java.lang RuntimeException RuntimeException.

Prototype

public RuntimeException(Throwable cause) 

Source Link

Document

Constructs a new runtime exception with the specified cause and a detail message of (cause==null ?

Usage

From source file:com.diversityarrays.dal.server.DalServer.java

public static void main(String[] args) {

    String host = null;//www  . j a va2 s. c om
    int port = DalServerUtil.DEFAULT_DAL_SERVER_PORT;

    int inactiveMins = DalServerUtil.DEFAULT_MAX_INACTIVE_MINUTES;

    File docRoot = null;

    String serviceName = null;

    for (int i = 0; i < args.length; ++i) {
        String argi = args[i];
        if (argi.startsWith("-")) {
            if ("--".equals(argi)) {
                break;
            }

            if ("-version".equals(argi)) {
                System.out.println(DAL_SERVER_VERSION);
                System.exit(0);
            }

            if ("-help".equals(argi)) {
                giveHelpThenExit(0);
            }

            if ("-docroot".equals(argi)) {
                if (++i >= args.length || args[i].startsWith("-")) {
                    fatal("missing value for " + argi);
                }
                docRoot = new File(args[i]);
            } else if ("-sqllog".equals(argi)) {
                SqlUtil.logger = Logger.getLogger(SqlUtil.class.getName());
            } else if ("-expire".equals(argi)) {
                if (++i >= args.length || args[i].startsWith("-")) {
                    fatal("missing value for " + argi);
                }

                try {
                    inactiveMins = Integer.parseInt(args[i], 10);
                    if (inactiveMins <= 0) {
                        fatal("invalid minutes: " + args[i]);
                    }
                } catch (NumberFormatException e) {
                    fatal("invalid minutes: " + args[i]);
                }
            } else if ("-localhost".equals(argi)) {
                host = "localhost";
            } else if ("-port".equals(argi)) {
                if (++i >= args.length || args[i].startsWith("-")) {
                    fatal("missing value for " + argi);
                }
                try {
                    port = Integer.parseInt(args[i], 10);
                    if (port < 0 || port > 65535) {
                        fatal("invalid port number: " + args[i]);
                    }
                } catch (NumberFormatException e) {
                    fatal("invalid port number: " + args[i]);
                }
            } else {
                fatal("invalid option: " + argi);
            }
        } else {
            if (serviceName != null) {
                fatal("multiple serviceNames not supported: " + argi);
            }
            serviceName = argi;
        }
    }

    final DalServerPreferences preferences = new DalServerPreferences(
            Preferences.userNodeForPackage(DalServer.class));

    if (docRoot == null) {
        docRoot = preferences.getWebRoot(new File(System.getProperty("user.dir"), "www"));
    }

    DalServer server = null;

    if (serviceName != null && docRoot.isDirectory()) {
        try {
            DalDatabase db = createDalDatabase(serviceName, preferences);
            if (db.isInitialiseRequired()) {
                Closure<String> progress = new Closure<String>() {
                    @Override
                    public void execute(String msg) {
                        System.out.println("Database Initialisation: " + msg);
                    }
                };
                db.initialise(progress);
            }
            server = create(preferences, host, port, docRoot, db);
        } catch (NoServiceException e) {
            throw new RuntimeException(e);
        } catch (DalDbException e) {
            throw new RuntimeException(e);
        }
    }

    Image serverIconImage = null;
    InputStream imageIs = DalServer.class.getResourceAsStream("dalserver-24.png");
    if (imageIs != null) {
        try {
            serverIconImage = ImageIO.read(imageIs);

            if (Util.isMacOS()) {
                try {
                    MacApplication macapp = new MacApplication(null);
                    macapp.setDockIconImage(serverIconImage);
                } catch (MacApplicationException e) {
                    System.err.println(e.getMessage());
                }
            }

        } catch (IOException ignore) {
        }
    }

    if (server != null) {
        server.setMaxInactiveMinutes(inactiveMins);
    } else {
        AskServerParams asker = new AskServerParams(serverIconImage, null, "DAL Server Start", docRoot,
                preferences);
        GuiUtil.centreOnScreen(asker);
        asker.setVisible(true);

        if (asker.cancelled) {
            System.exit(0);
        }

        host = asker.dalServerHostName;
        port = asker.dalServerPort;
        inactiveMins = asker.maxInactiveMinutes;

        server = create(preferences, host, port, asker.wwwRoot, asker.dalDatabase);
        // server.setUseSimpleDatabase(asker.useSimpleDatabase);
    }

    final DalServer f_server = server;
    final File f_wwwRoot = docRoot;
    final Image f_serverIconImage = serverIconImage;

    SwingUtilities.invokeLater(new Runnable() {
        @Override
        public void run() {
            DalServerFactory factory = new DalServerFactory() {
                @Override
                public DalServer create(String hostName, int port, File wwwRoot, DalDatabase dalDatabase) {
                    return DalServer.create(preferences, hostName, port, wwwRoot, dalDatabase);
                }
            };
            ServerGui gui = new ServerGui(f_serverIconImage, f_server, factory, f_wwwRoot, preferences);
            gui.setVisible(true);
        }
    });

}

---

From source file:edu.msu.cme.rdp.graph.utils.ContigMerger.java

public static void main(String[] args) throws IOException {
    final BufferedReader hmmgsResultReader;
    final IndexedSeqReader nuclContigReader;
    final double minBits;
    final int minProtLength;
    final Options options = new Options();
    final PrintStream out;
    final ProfileHMM hmm;
    final FastaWriter protSeqOut;
    final FastaWriter nuclSeqOut;
    final boolean prot;
    final boolean all;
    final String shortSampleName;

    options.addOption("a", "all", false,
            "Generate all combinations for multiple paths, instead of just the best");
    options.addOption("b", "min-bits", true, "Minimum bits score");
    options.addOption("l", "min-length", true, "Minimum length");
    options.addOption("s", "short_samplename", true,
            "short sample name, to be used as part of contig identifiers. This allow analyzing contigs together from different samples in downstream analysis ");
    options.addOption("o", "out", true, "Write output to file instead of stdout");

    try {//from   w  w  w  .j a  va 2 s  .c  o  m
        CommandLine line = new PosixParser().parse(options, args);

        if (line.hasOption("min-bits")) {
            minBits = Double.valueOf(line.getOptionValue("min-bits"));
        } else {
            minBits = Double.NEGATIVE_INFINITY;
        }

        if (line.hasOption("min-length")) {
            minProtLength = Integer.valueOf(line.getOptionValue("min-length"));
        } else {
            minProtLength = 0;
        }

        if (line.hasOption("short_samplename")) {
            shortSampleName = line.getOptionValue("short_samplename") + "_";
        } else {
            shortSampleName = "";
        }

        if (line.hasOption("out")) {
            out = new PrintStream(line.getOptionValue("out"));
        } else {
            out = System.err;
        }

        all = line.hasOption("all");

        args = line.getArgs();

        if (args.length != 3) {
            throw new Exception("Unexpected number of arguments");
        }

        hmmgsResultReader = new BufferedReader(new FileReader(new File(args[1])));
        nuclContigReader = new IndexedSeqReader(new File(args[2]));
        hmm = HMMER3bParser.readModel(new File(args[0]));

        prot = (hmm.getAlphabet() == SequenceType.Protein);

        if (prot) {
            protSeqOut = new FastaWriter(new File("prot_merged.fasta"));
        } else {
            protSeqOut = null;
        }
        nuclSeqOut = new FastaWriter(new File("nucl_merged.fasta"));

    } catch (Exception e) {
        new HelpFormatter().printHelp("USAGE: ContigMerger [options] <hmm> <hmmgs_file> <nucl_contig>",
                options);
        System.err.println("Error: " + e.getMessage());
        System.exit(1);
        throw new RuntimeException("I hate you javac");
    }

    String line;
    SearchDirection lastDir = SearchDirection.left; //So this has an assumption built in
    //It depends on hmmgs always outputting left fragments, then right
    //We can't just use the kmer to figure out if we've switched to another starting point
    //because we allow multiple starting model pos, so two different starting
    //positions can have the same starting kmer

    Map<String, Sequence> leftContigs = new HashMap();
    Map<String, Sequence> rightContigs = new HashMap();

    int contigsMerged = 0;
    int writtenMerges = 0;
    long startTime = System.currentTimeMillis();
    String kmer = null;
    String geneName = null;

    while ((line = hmmgsResultReader.readLine()) != null) {
        if (line.startsWith("#")) {
            continue;
        }

        String[] lexemes = line.trim().split("\t");
        if (lexemes.length != 12 || lexemes[0].equals("-")) {
            System.err.println("Skipping line: " + line);
            continue;
        }
        //contig_53493   nirk   1500:6:35:16409:3561/1   ADV15048   tcggcgctctacacgttcctgcagcccggg   40   210   70   left   -44.692   184   0
        int index = 0;

        String seqid = lexemes[0];
        geneName = lexemes[1];
        String readid = lexemes[2];
        String refid = lexemes[3];
        kmer = lexemes[4];
        int modelStart = Integer.valueOf(lexemes[5]);

        int nuclLength = Integer.valueOf(lexemes[6]);
        int protLength = Integer.valueOf(lexemes[7]);

        SearchDirection dir = SearchDirection.valueOf(lexemes[8]);
        if (dir != lastDir) {
            if (dir == SearchDirection.left) {
                List<MergedContig> mergedContigs = all
                        ? mergeAllContigs(leftContigs, rightContigs, kmer, geneName, hmm)
                        : mergeContigs(leftContigs, rightContigs, kmer, geneName, hmm);

                contigsMerged++;

                for (MergedContig mc : mergedContigs) {
                    String mergedId = shortSampleName + geneName + "_" + mc.leftContig + "_" + mc.rightContig;
                    out.println(mergedId + "\t" + mc.length + "\t" + mc.score);

                    if (mc.score > minBits && mc.length > minProtLength) {
                        if (prot) {
                            protSeqOut.writeSeq(mergedId, mc.protSeq);
                        }
                        nuclSeqOut.writeSeq(mergedId, mc.nuclSeq);

                        writtenMerges++;
                    }
                }
                leftContigs.clear();
                rightContigs.clear();
            }

            lastDir = dir;
        }

        Sequence seq = nuclContigReader.readSeq(seqid);

        if (dir == SearchDirection.left) {
            leftContigs.put(seqid, seq);
        } else if (dir == SearchDirection.right) {
            rightContigs.put(seqid, seq);
        } else {
            throw new IOException("Cannot handle search direction " + dir);
        }
    }

    if (!leftContigs.isEmpty() || !rightContigs.isEmpty()) {
        List<MergedContig> mergedContigs = all ? mergeAllContigs(leftContigs, rightContigs, kmer, geneName, hmm)
                : mergeContigs(leftContigs, rightContigs, kmer, geneName, hmm);

        for (MergedContig mc : mergedContigs) {
            String mergedId = shortSampleName + mc.gene + "_" + mc.leftContig + "_" + mc.rightContig;
            out.println(mergedId + "\t" + mc.length + "\t" + mc.score);
            contigsMerged++;

            if (mc.score > minBits && mc.length > minProtLength) {
                if (prot) {
                    protSeqOut.writeSeq(mergedId, mc.protSeq);
                }
                nuclSeqOut.writeSeq(mergedId, mc.nuclSeq);
                writtenMerges++;
            }
        }
    }

    out.close();
    if (prot) {
        protSeqOut.close();
    }
    nuclSeqOut.close();

    System.err.println("Read in " + contigsMerged + " contigs, wrote out " + writtenMerges
            + " merged contigs in " + ((double) (System.currentTimeMillis() - startTime) / 1000) + "s");
}

---

From source file:Main.java

public static boolean isETC1Supported() {
    throw new RuntimeException("Stub!");
}

---

From source file:Main.java

public static final void throwInternal() {
    throw new RuntimeException("Internal error: this code path should never get executed");
}

---

From source file:Main.java

public static <T> T[] arrayOf(T... views) {
    throw new RuntimeException("Stub!");
}

---

From source file:Main.java

public static long currentAnimationTimeMillis() {
    throw new RuntimeException("Stub!");
}

---

From source file:Main.java

public static final boolean isNonSeparator(char c) {
    throw new RuntimeException("Stub!");
}

---

From source file:Main.java

public static int toaFromString(java.lang.String s) {
    throw new RuntimeException("Stub!");
}

---

From source file:Main.java

public static final boolean isStartsPostDial(char c) {
    throw new RuntimeException("Stub!");
}

---

From source file:Main.java

public static final boolean isReallyDialable(char c) {
    throw new RuntimeException("Stub!");
}

---

• «
• 1
• 2
• 3
• 4
• 5
• 6
• 7
• 8
• 9
• 10
• 11
• 12
• 13
• 14
• 15
• 16
• 17
• 18
• 19
• 20
• 21
• 22
• 23
• 24
• 25
• 26
• 27
• 28
• 29
• 30
• 31
• 32
• 33
• 34
• 35
• 36
• 37
• 38
• 39
• 40
• 41
• 42
• 43
• 44
• 45
• »