hadoop.inputsplit.FastaLineRecordReader.java Source code

Java tutorial

Introduction

Here is the source code for hadoop.inputsplit.FastaLineRecordReader.java

Source

/**
 * Licensed to the Apache Software Foundation (ASF) under one
 * or more contributor license agreements.  See the NOTICE file
 * distributed with this work for additional information
 * regarding copyright ownership.  The ASF licenses this file
 * to you under the Apache License, Version 2.0 (the
 * "License"); you may not use this file except in compliance
 * with the License.  You may obtain a copy of the License at
 *
 *     http://www.apache.org/licenses/LICENSE-2.0
 *
 * Unless required by applicable law or agreed to in writing, software
 * distributed under the License is distributed on an "AS IS" BASIS,
 * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
 * See the License for the specific language governing permissions and
 * limitations under the License.
 */

package hadoop.inputsplit;

import hadoop.HadoopUtil;

import java.io.IOException;
import java.io.UnsupportedEncodingException;

import org.apache.hadoop.conf.Configuration;
import org.apache.hadoop.fs.FSDataInputStream;
import org.apache.hadoop.fs.FileSystem;
import org.apache.hadoop.fs.Path;
import org.apache.hadoop.fs.Seekable;
import org.apache.hadoop.io.Text;
import org.apache.hadoop.io.compress.CodecPool;
import org.apache.hadoop.io.compress.CompressionCodec;
import org.apache.hadoop.io.compress.CompressionCodecFactory;
import org.apache.hadoop.io.compress.Decompressor;
import org.apache.hadoop.io.compress.SplitCompressionInputStream;
import org.apache.hadoop.io.compress.SplittableCompressionCodec;
import org.apache.hadoop.mapreduce.InputSplit;
import org.apache.hadoop.mapreduce.RecordReader;
import org.apache.hadoop.mapreduce.TaskAttemptContext;
import org.apache.hadoop.mapreduce.lib.input.FileSplit;
import org.apache.hadoop.util.LineReader;
import org.apache.commons.logging.LogFactory;
import org.apache.commons.logging.Log;

import utility.Constant;

/**
 * 
 * @author Apache Software Foundation (ASF) 
 * Modified by: Gianluca Roscigno - email: giroscigno@unisa.it - http://www.di.unisa.it/~roscigno/
 * 
 * @version 1.5
 * 
 * Date: February, 1 2015
 * 
 * Code from org.apache.hadoop.mapreduce.lib.input.LineRecordReader.java
 * 
 * This class reads <key, value> pair from an InputSplit. 
 * The input file is in FASTA format.
 * This class is used when there is an unique large genomic sequence/string in a FASTA file.
 * Assumption: A file contains a single very large string genomics.
 * 
 * Example input file:
 * >Seq1
 * ACTG
 * CTGACTGA
 * GACTGACTGACT
 * TGACTGACTGACTGAC
 * ACTGACTGACTGACTGACTG
 * 
 * Records:
 * <Seq1, (ACTGCTGACTGATGAC,CTG)>
 * <Seq1, (CTGACTGACTGACTGA,GAC)>
 * <Seq1, (GACTGACTGACTTGAC,TGA)>
 * <Seq1, (TGACTGACTGACTTGA,ACT)>
 * <Seq1, (ACTG,)>
 * 
 * In <IdSeq, (currLine, kcharsFromNextLine)>, kcharsFromNextLine is almost the size of the length, e.g. 80.
 * 
 */
/*
 * In questo caso ogni file di input  molto grande e contiene una sola sequenza genomica.
 * Tutte le righe del file sono lunghe Constant.FASTA_MAX_LINE_LENGTH=80 caratteri tranne la prima (id delle sequenza).
 * L'ultima riga pu contenere meno di Constant.FASTA_MAX_LINE_LENGTH.
 * Nel nostro caso la dimensione del pattern k deve essere minore o uguale a Constant.FASTA_MAX_LINE_LENGTH.
 */
public class FastaLineRecordReader extends RecordReader<Text, ValueWritable> {

    private static final Log LOG = LogFactory.getLog(FastaLineRecordReader.class);

    private CompressionCodecFactory compressionCodecs = null;
    private long start;
    private long pos;
    private long end;
    private LineReader in;
    private int maxLineLength;
    private Seekable filePosition;
    private CompressionCodec codec;
    private Decompressor decompressor;
    private byte[] recordDelimiterBytes = null;
    private Path file;
    private boolean done;
    private Text currentKey = null;
    private Text value = null;
    private ValueWritable currentValue = null;
    private Text tmpValue = null;
    private Text oldValue;
    private Text tmp;
    private int maxK = 0;
    private int numErrors = 0;

    public FastaLineRecordReader() {
        try {
            this.recordDelimiterBytes = "\n".getBytes("UTF-8");
        } catch (UnsupportedEncodingException e) {
            LOG.error(e.getMessage());
        }
    }

    public FastaLineRecordReader(byte[] recordDelimiter) {
        this.recordDelimiterBytes = recordDelimiter;
    }

    public void initialize(InputSplit genericSplit, TaskAttemptContext context) throws IOException {

        FileSplit split = (FileSplit) genericSplit;
        Configuration job = context.getConfiguration();

        done = false;

        this.maxLineLength = job.getInt("mapred.linerecordreader.maxlength", Integer.MAX_VALUE);
        start = split.getStart();
        end = start + split.getLength();

        file = split.getPath();
        compressionCodecs = new CompressionCodecFactory(job);
        codec = compressionCodecs.getCodec(file);

        currentValue = new ValueWritable();
        value = new Text();
        tmpValue = new Text();
        tmp = new Text();

        // open the file and seek to the start of the split
        FileSystem fs = file.getFileSystem(job);
        FSDataInputStream fileIn = fs.open(split.getPath());

        String homeHdfs = context.getConfiguration().get("HDFS_HOME_DIR");
        //maxK = HadoopUtil.getMaxkFromPatterns(fs, new Path(homeHdfs+Constant.HDFS_PATTERNS_FILE_HDFS));

        if (isCompressedInput()) {
            decompressor = CodecPool.getDecompressor(codec);
            if (codec instanceof SplittableCompressionCodec) {
                final SplitCompressionInputStream cIn = ((SplittableCompressionCodec) codec).createInputStream(
                        fileIn, decompressor, start, end, SplittableCompressionCodec.READ_MODE.BYBLOCK);
                in = new LineReader(cIn, job, recordDelimiterBytes);
                start = cIn.getAdjustedStart();
                end = cIn.getAdjustedEnd();
                filePosition = cIn;
            } else {
                in = new LineReader(codec.createInputStream(fileIn, decompressor), job, recordDelimiterBytes);
                filePosition = fileIn;
            }
        } else {
            fileIn.seek(start);
            in = new LineReader(fileIn, job, recordDelimiterBytes);
            filePosition = fileIn;
        }
        // If this is not the first split, we always throw away first record
        // because we always (except the last split) read one extra line in
        // next() method.
        if (start != 0) {
            start += in.readLine(new Text(), 0, maxBytesToConsume(start));
        }
        this.pos = start;

        setKeySeq(fs, job); //Set currentKey

        nextMyKeyValue(); //Leggo il primo record se esiste.

    }

    private void setKeySeq(FileSystem fs, Configuration job) { //Set currentKey

        if (Constant.SPLIT2_DEBUG_MODE)
            currentKey = new Text(file.getName() + "." + start);
        else {
            try {
                LineReader reader = new LineReader(fs.open(file), job, recordDelimiterBytes);
                currentKey = new Text();
                reader.readLine(currentKey, maxLineLength);
                reader.close();
                currentKey.set(currentKey.toString().replaceAll(">", ""));
            } catch (Exception e) {
                LOG.error(e.getMessage());
                currentKey = new Text(file.getName());
            }
        }

    }

    private boolean isCompressedInput() {
        return (codec != null);
    }

    private int maxBytesToConsume(long pos) {
        return isCompressedInput() ? Integer.MAX_VALUE
                : (int) Math.max(Math.min(Integer.MAX_VALUE, end - pos), maxLineLength);
    }

    private long getFilePosition() throws IOException {
        long retVal;
        if (isCompressedInput() && null != filePosition) {
            retVal = filePosition.getPos();
        } else {
            retVal = pos;
        }
        return retVal;
    }

    private int skipUtfByteOrderMark() throws IOException {
        // Strip BOM(Byte Order Mark)
        // Text only support UTF-8, we only need to check UTF-8 BOM
        // (0xEF,0xBB,0xBF) at the start of the text stream.
        int newMaxLineLength = (int) Math.min(3L + (long) maxLineLength, Integer.MAX_VALUE);
        int newSize = in.readLine(value, newMaxLineLength, maxBytesToConsume(pos));
        // Even we read 3 extra bytes for the first line,
        // we won't alter existing behavior (no backwards incompat issue).
        // Because the newSize is less than maxLineLength and
        // the number of bytes copied to Text is always no more than newSize.
        // If the return size from readLine is not less than maxLineLength,
        // we will discard the current line and read the next line.
        pos += newSize;
        int textLength = value.getLength();
        byte[] textBytes = value.getBytes();
        if ((textLength >= 3) && (textBytes[0] == (byte) 0xEF) && (textBytes[1] == (byte) 0xBB)
                && (textBytes[2] == (byte) 0xBF)) {
            // find UTF-8 BOM, strip it.
            LOG.info("Found UTF-8 BOM and skipped it");
            textLength -= 3;
            newSize -= 3;
            if (textLength > 0) {
                // It may work to use the same buffer and not do the copyBytes
                textBytes = value.copyBytes();
                value.set(textBytes, 3, textLength);
            } else {
                value.clear();
            }
        }
        return newSize;
    }

    public boolean nextMyKeyValue() throws IOException {

        if (value == null)
            value = new Text();

        int newSize = 0;
        // We always read one extra line, which lies outside the upper split limit i.e. (end - 1)
        while (getFilePosition() <= end) {
            if (pos == 0) {
                newSize = skipUtfByteOrderMark();
            } else {
                newSize = in.readLine(value, maxLineLength, maxBytesToConsume(pos));
                /*
                 *     maxLineLength - the maximum number of bytes to store into str; the rest of the line is silently discarded.
                 *     
                 *     maxBytesToConsume - the maximum number of bytes to consume in this call. 
                 *     This is only a hint, because if the line cross this threshold, we allow it to happen. 
                 *     It can overshoot potentially by as much as one buffer length. 
                 */

                pos += newSize;
            }

            if ((newSize == 0) || (newSize < maxLineLength)) {
                if (!value.toString().startsWith(">"))
                    break;
            }

            // line too long. try again
            LOG.info("Skipped line of size " + newSize + " at pos " + (pos - newSize));
        }

        if (newSize == 0) {
            value = null;
            return false;
        } else {
            //System.err.println(currentKey+" "+currentValue);
            return true;
        }
    }

    public boolean nextOtherKeyValue() throws IOException {

        if (value == null)
            value = new Text();

        int newSize = 0;
        // We always read one extra line, which lies outside the upper split limit i.e. (end - 1)
        while (true) {
            if (pos == 0) {
                newSize = skipUtfByteOrderMark();
            } else {
                newSize = in.readLine(value, maxLineLength, maxBytesToConsume(pos));
                pos += newSize;
            }

            if ((newSize == 0) || (newSize < maxLineLength)) {
                break;
            }

            // line too long. try again
            LOG.info("Skipped line of size " + newSize + " at pos " + (pos - newSize));
        }
        if (newSize == 0) {
            if (Constant.DEBUG_MODE)
                System.out.println("END INPUT FILE");
            //END INPUT FILE
            value = null;
            return false;
        } else {
            if (Constant.DEBUG_MODE)
                System.out.println("LINE AT SPLIT+1");
            //LINE AT SPLIT+1
            return true;
        }
    }

    public boolean nextKeyValue() throws IOException {

        if (value == null || done)
            return false;

        /* Invece di "tmpValue = new Text(value.toString());" 
         * uso le tre istruzioni sotto per riciclare gli oggetti.
         * 
         */
        oldValue = tmpValue;
        tmpValue = value;
        value = oldValue;

        boolean res = nextMyKeyValue();

        if (!res) {
            nextOtherKeyValue();
            done = true;
        }

        //System.err.println(currentKey+" "+tmpValue+ "-"+value);
        currentValue.setCurrLine(tmpValue);

        int c = 0;

        if (Constant.SPLIT2_DEBUG_MODE)
            currentValue.setNextLine(value);
        else {//Esecuzione normale.
            try {
                if (value != null && value.getLength() > 0) {
                    /* Scrivo solo la stringa che mi interessa. */
                    c = Math.min(value.toString().length(), maxK); //Si prendono i primi k caratteri se esistono.
                    tmp.set(value.toString().substring(0, c));
                    currentValue.setNextLine(tmp);
                } else
                    currentValue.setNextLine(null);
            } catch (Exception e) {
                e.printStackTrace();
                numErrors++;
            }
        }

        return true;

    }

    @Override
    public Text getCurrentKey() {
        return currentKey;
    }

    @Override
    public ValueWritable getCurrentValue() {
        return currentValue;
    }

    /**
     * Get the progress within the split
     */
    public float getProgress() {

        if (done)
            return 1.0f;

        if (start == end) {
            return 0.0f;
        } else {
            try {
                return Math.min(1.0f, (getFilePosition() - start) / (float) (end - start));
            } catch (IOException ioe) {
                throw new RuntimeException(ioe);
            }
        }
    }

    public synchronized void close() throws IOException {
        try {
            if (in != null) {
                in.close();
            }
        } finally {
            if (decompressor != null) {
                CodecPool.returnDecompressor(decompressor);
            }
            if (Constant.DEBUG_MODE)
                System.out.println("Number of errors: " + numErrors);
        }
    }
}