Example usage for java.util Map put

List of usage examples for java.util Map put

Introduction

In this page you can find the example usage for java.util Map put.

Prototype

V put(K key, V value);

Source Link

Document

Associates the specified value with the specified key in this map (optional operation).

Usage

From source file:com.searchcode.app.App.java

public static void main(String[] args) {
    injector = Guice.createInjector(new InjectorConfig());
    int server_port = Helpers.tryParseInt(
            Properties.getProperties().getProperty(Values.SERVERPORT, Values.DEFAULTSERVERPORT),
            Values.DEFAULTSERVERPORT);//from  w w w. j  a v a 2 s.  c  o m
    boolean onlyLocalhost = Boolean
            .parseBoolean(Properties.getProperties().getProperty("only_localhost", "false"));

    // Database migrations happen before we start
    databaseMigrations();

    LOGGER.info("Starting searchcode server on port " + server_port);
    Spark.port(server_port);

    JobService js = injector.getInstance(JobService.class);
    Repo repo = injector.getInstance(Repo.class);
    Data data = injector.getInstance(Data.class);
    Api api = injector.getInstance(Api.class);

    ApiService apiService = injector.getInstance(ApiService.class);
    StatsService statsService = new StatsService();

    scl = Singleton.getSearchcodeLib(data);
    js.initialJobs();

    Gson gson = new Gson();

    Spark.staticFileLocation("/public");

    before((request, response) -> {
        if (onlyLocalhost) {
            if (!request.ip().equals("127.0.0.1")) {
                halt(204);
            }
        }
    });

    get("/", (req, res) -> {
        Map<String, Object> map = new HashMap<>();

        map.put("repoCount", repo.getRepoCount());

        if (req.queryParams().contains("q") && !req.queryParams("q").trim().equals("")) {
            String query = req.queryParams("q").trim();
            int page = 0;

            if (req.queryParams().contains("p")) {
                try {
                    page = Integer.parseInt(req.queryParams("p"));
                    page = page > 19 ? 19 : page;
                } catch (NumberFormatException ex) {
                    page = 0;
                }
            }

            List<String> reposList = new ArrayList<>();
            List<String> langsList = new ArrayList<>();
            List<String> ownsList = new ArrayList<>();

            if (req.queryParams().contains("repo")) {
                String[] repos = new String[0];
                repos = req.queryParamsValues("repo");

                if (repos.length != 0) {
                    reposList = Arrays.asList(repos);
                }
            }

            if (req.queryParams().contains("lan")) {
                String[] langs = new String[0];
                langs = req.queryParamsValues("lan");

                if (langs.length != 0) {
                    langsList = Arrays.asList(langs);
                }
            }

            if (req.queryParams().contains("own")) {
                String[] owns = new String[0];
                owns = req.queryParamsValues("own");

                if (owns.length != 0) {
                    ownsList = Arrays.asList(owns);
                }
            }

            map.put("searchValue", query);
            map.put("searchResultJson",
                    gson.toJson(new CodePreload(query, page, langsList, reposList, ownsList)));

            map.put("logoImage", getLogo());
            map.put("isCommunity", ISCOMMUNITY);
            return new ModelAndView(map, "search_test.ftl");
        }

        // Totally pointless vanity but lets rotate the image every week
        int photoId = getWeekOfMonth();

        if (photoId <= 0) {
            photoId = 3;
        }
        if (photoId > 4) {
            photoId = 2;
        }

        CodeSearcher cs = new CodeSearcher();

        map.put("photoId", photoId);
        map.put("numDocs", cs.getTotalNumberDocumentsIndexed());
        map.put("logoImage", getLogo());
        map.put("isCommunity", ISCOMMUNITY);
        return new ModelAndView(map, "index.ftl");
    }, new FreeMarkerEngine());

    get("/html/", (req, res) -> {
        CodeSearcher cs = new CodeSearcher();
        CodeMatcher cm = new CodeMatcher(data);
        Map<String, Object> map = new HashMap<>();

        map.put("repoCount", repo.getRepoCount());

        if (req.queryParams().contains("q")) {
            String query = req.queryParams("q").trim();
            String altquery = query.replaceAll("[^A-Za-z0-9 ]", " ").trim().replaceAll(" +", " ");
            int page = 0;

            if (req.queryParams().contains("p")) {
                try {
                    page = Integer.parseInt(req.queryParams("p"));
                    page = page > 19 ? 19 : page;
                } catch (NumberFormatException ex) {
                    page = 0;
                }
            }

            String[] repos = new String[0];
            String[] langs = new String[0];
            String reposFilter = "";
            String langsFilter = "";
            String reposQueryString = "";
            String langsQueryString = "";

            if (req.queryParams().contains("repo")) {
                repos = req.queryParamsValues("repo");

                if (repos.length != 0) {
                    List<String> reposList = Arrays.asList(repos).stream()
                            .map((s) -> "reponame:" + QueryParser.escape(s)).collect(Collectors.toList());

                    reposFilter = " && (" + StringUtils.join(reposList, " || ") + ")";

                    List<String> reposQueryList = Arrays.asList(repos).stream()
                            .map((s) -> "&repo=" + URLEncoder.encode(s)).collect(Collectors.toList());

                    reposQueryString = StringUtils.join(reposQueryList, "");
                }
            }

            if (req.queryParams().contains("lan")) {
                langs = req.queryParamsValues("lan");

                if (langs.length != 0) {
                    List<String> langsList = Arrays.asList(langs).stream()
                            .map((s) -> "languagename:" + QueryParser.escape(s)).collect(Collectors.toList());

                    langsFilter = " && (" + StringUtils.join(langsList, " || ") + ")";

                    List<String> langsQueryList = Arrays.asList(langs).stream()
                            .map((s) -> "&lan=" + URLEncoder.encode(s)).collect(Collectors.toList());

                    langsQueryString = StringUtils.join(langsQueryList, "");
                }
            }

            // split the query escape it and and it together
            String cleanQueryString = scl.formatQueryString(query);

            SearchResult searchResult = cs.search(cleanQueryString + reposFilter + langsFilter, page);
            searchResult.setCodeResultList(cm.formatResults(searchResult.getCodeResultList(), query, true));

            for (CodeFacetRepo f : searchResult.getRepoFacetResults()) {
                if (Arrays.asList(repos).contains(f.getRepoName())) {
                    f.setSelected(true);
                }
            }

            for (CodeFacetLanguage f : searchResult.getLanguageFacetResults()) {
                if (Arrays.asList(langs).contains(f.getLanguageName())) {
                    f.setSelected(true);
                }
            }

            map.put("searchValue", query);
            map.put("searchResult", searchResult);
            map.put("reposQueryString", reposQueryString);
            map.put("langsQueryString", langsQueryString);

            map.put("altQuery", altquery);

            map.put("isHtml", true);
            map.put("logoImage", getLogo());
            map.put("isCommunity", ISCOMMUNITY);
            return new ModelAndView(map, "searchresults.ftl");
        }

        // Totally pointless vanity but lets rotate the image every week
        int photoId = getWeekOfMonth();

        if (photoId <= 0) {
            photoId = 3;
        }
        if (photoId > 4) {
            photoId = 2;
        }

        map.put("photoId", photoId);
        map.put("numDocs", cs.getTotalNumberDocumentsIndexed());
        map.put("logoImage", getLogo());
        map.put("isCommunity", ISCOMMUNITY);
        return new ModelAndView(map, "index.ftl");
    }, new FreeMarkerEngine());

    /**
     * Allows one to write literal lucene search queries against the index
     * TODO This is still very much WIP
     */
    get("/literal/", (req, res) -> {
        CodeSearcher cs = new CodeSearcher();
        CodeMatcher cm = new CodeMatcher(data);
        Map<String, Object> map = new HashMap<>();

        map.put("repoCount", repo.getRepoCount());

        if (req.queryParams().contains("q")) {
            String query = req.queryParams("q").trim();

            int page = 0;

            if (req.queryParams().contains("p")) {
                try {
                    page = Integer.parseInt(req.queryParams("p"));
                    page = page > 19 ? 19 : page;
                } catch (NumberFormatException ex) {
                    page = 0;
                }
            }

            String altquery = query.replaceAll("[^A-Za-z0-9 ]", " ").trim().replaceAll(" +", " ");

            SearchResult searchResult = cs.search(query, page);
            searchResult.setCodeResultList(cm.formatResults(searchResult.getCodeResultList(), altquery, false));

            map.put("searchValue", query);
            map.put("searchResult", searchResult);
            map.put("reposQueryString", "");
            map.put("langsQueryString", "");

            map.put("altQuery", "");

            map.put("logoImage", getLogo());
            map.put("isCommunity", ISCOMMUNITY);
            return new ModelAndView(map, "searchresults.ftl");
        }

        map.put("numDocs", cs.getTotalNumberDocumentsIndexed());
        map.put("logoImage", getLogo());
        map.put("isCommunity", ISCOMMUNITY);
        return new ModelAndView(map, "index.ftl");
    }, new FreeMarkerEngine());

    /**
     * This is the endpoint used by the frontend.
     */
    get("/api/codesearch/", (req, res) -> {
        CodeSearcher cs = new CodeSearcher();
        CodeMatcher cm = new CodeMatcher(data);

        if (req.queryParams().contains("q") && req.queryParams("q").trim() != "") {
            String query = req.queryParams("q").trim();

            int page = 0;

            if (req.queryParams().contains("p")) {
                try {
                    page = Integer.parseInt(req.queryParams("p"));
                    page = page > 19 ? 19 : page;
                } catch (NumberFormatException ex) {
                    page = 0;
                }
            }

            String[] repos = new String[0];
            String[] langs = new String[0];
            String[] owners = new String[0];
            String reposFilter = "";
            String langsFilter = "";
            String ownersFilter = "";

            if (req.queryParams().contains("repo")) {
                repos = req.queryParamsValues("repo");

                if (repos.length != 0) {
                    List<String> reposList = Arrays.asList(repos).stream()
                            .map((s) -> "reponame:" + QueryParser.escape(s)).collect(Collectors.toList());

                    reposFilter = " && (" + StringUtils.join(reposList, " || ") + ")";
                }
            }

            if (req.queryParams().contains("lan")) {
                langs = req.queryParamsValues("lan");

                if (langs.length != 0) {
                    List<String> langsList = Arrays.asList(langs).stream()
                            .map((s) -> "languagename:" + QueryParser.escape(s)).collect(Collectors.toList());

                    langsFilter = " && (" + StringUtils.join(langsList, " || ") + ")";
                }
            }

            if (req.queryParams().contains("own")) {
                owners = req.queryParamsValues("own");

                if (owners.length != 0) {
                    List<String> ownersList = Arrays.asList(owners).stream()
                            .map((s) -> "codeowner:" + QueryParser.escape(s)).collect(Collectors.toList());

                    ownersFilter = " && (" + StringUtils.join(ownersList, " || ") + ")";
                }
            }

            // Need to pass in the filters into this query
            String cacheKey = query + page + reposFilter + langsFilter + ownersFilter;

            if (cache.containsKey(cacheKey)) {
                return cache.get(cacheKey);
            }

            // split the query escape it and and it together
            String cleanQueryString = scl.formatQueryString(query);

            SearchResult searchResult = cs.search(cleanQueryString + reposFilter + langsFilter + ownersFilter,
                    page);
            searchResult.setCodeResultList(cm.formatResults(searchResult.getCodeResultList(), query, true));

            searchResult.setQuery(query);

            for (String altQuery : scl.generateAltQueries(query)) {
                searchResult.addAltQuery(altQuery);
            }

            // Null out code as it isnt required and there is no point in bloating our ajax requests
            for (CodeResult codeSearchResult : searchResult.getCodeResultList()) {
                codeSearchResult.setCode(null);
            }

            cache.put(cacheKey, searchResult);
            return searchResult;
        }

        return null;
    }, new JsonTransformer());

    get("/api/repo/add/", "application/json", (request, response) -> {
        boolean apiEnabled = Boolean
                .parseBoolean(Properties.getProperties().getProperty("api_enabled", "false"));
        boolean apiAuth = Boolean
                .parseBoolean(Properties.getProperties().getProperty("api_key_authentication", "true"));

        if (!apiEnabled) {
            return new ApiResponse(false, "API not enabled");
        }

        String publicKey = request.queryParams("pub");
        String signedKey = request.queryParams("sig");
        String reponames = request.queryParams("reponame");
        String repourls = request.queryParams("repourl");
        String repotype = request.queryParams("repotype");
        String repousername = request.queryParams("repousername");
        String repopassword = request.queryParams("repopassword");
        String reposource = request.queryParams("reposource");
        String repobranch = request.queryParams("repobranch");

        if (reponames == null || reponames.trim().equals(Values.EMPTYSTRING)) {
            return new ApiResponse(false, "reponame is a required parameter");
        }

        if (repourls == null || repourls.trim().equals(Values.EMPTYSTRING)) {
            return new ApiResponse(false, "repourl is a required parameter");
        }

        if (repotype == null) {
            return new ApiResponse(false, "repotype is a required parameter");
        }

        if (repousername == null) {
            return new ApiResponse(false, "repousername is a required parameter");
        }

        if (repopassword == null) {
            return new ApiResponse(false, "repopassword is a required parameter");
        }

        if (reposource == null) {
            return new ApiResponse(false, "reposource is a required parameter");
        }

        if (repobranch == null) {
            return new ApiResponse(false, "repobranch is a required parameter");
        }

        if (apiAuth) {
            if (publicKey == null || publicKey.trim().equals(Values.EMPTYSTRING)) {
                return new ApiResponse(false, "pub is a required parameter");
            }

            if (signedKey == null || signedKey.trim().equals(Values.EMPTYSTRING)) {
                return new ApiResponse(false, "sig is a required parameter");
            }

            String toValidate = String.format(
                    "pub=%s&reponame=%s&repourl=%s&repotype=%s&repousername=%s&repopassword=%s&reposource=%s&repobranch=%s",
                    URLEncoder.encode(publicKey), URLEncoder.encode(reponames), URLEncoder.encode(repourls),
                    URLEncoder.encode(repotype), URLEncoder.encode(repousername),
                    URLEncoder.encode(repopassword), URLEncoder.encode(reposource),
                    URLEncoder.encode(repobranch));

            boolean validRequest = apiService.validateRequest(publicKey, signedKey, toValidate);

            if (!validRequest) {
                return new ApiResponse(false, "invalid signed url");
            }
        }

        // Clean
        if (repobranch == null || repobranch.trim().equals(Values.EMPTYSTRING)) {
            repobranch = "master";
        }

        repotype = repotype.trim().toLowerCase();
        if (!"git".equals(repotype) && !"svn".equals(repotype)) {
            repotype = "git";
        }

        RepoResult repoResult = repo.getRepoByName(reponames);

        if (repoResult != null) {
            return new ApiResponse(false, "repository name already exists");
        }

        repo.saveRepo(new RepoResult(-1, reponames, repotype, repourls, repousername, repopassword, reposource,
                repobranch));

        return new ApiResponse(true, "added repository successfully");
    }, new JsonTransformer());

    get("/api/repo/delete/", "application/json", (request, response) -> {
        boolean apiEnabled = Boolean
                .parseBoolean(Properties.getProperties().getProperty("api_enabled", "false"));
        boolean apiAuth = Boolean
                .parseBoolean(Properties.getProperties().getProperty("api_key_authentication", "true"));

        if (!apiEnabled) {
            return new ApiResponse(false, "API not enabled");
        }

        String publicKey = request.queryParams("pub");
        String signedKey = request.queryParams("sig");
        String reponames = request.queryParams("reponame");

        if (reponames == null || reponames.trim().equals(Values.EMPTYSTRING)) {
            return new ApiResponse(false, "reponame is a required parameter");
        }

        if (apiAuth) {
            if (publicKey == null || publicKey.trim().equals(Values.EMPTYSTRING)) {
                return new ApiResponse(false, "pub is a required parameter");
            }

            if (signedKey == null || signedKey.trim().equals(Values.EMPTYSTRING)) {
                return new ApiResponse(false, "sig is a required parameter");
            }

            String toValidate = String.format("pub=%s&reponame=%s", URLEncoder.encode(publicKey),
                    URLEncoder.encode(reponames));

            boolean validRequest = apiService.validateRequest(publicKey, signedKey, toValidate);

            if (!validRequest) {
                return new ApiResponse(false, "invalid signed url");
            }
        }

        RepoResult rr = repo.getRepoByName(reponames);
        if (rr == null) {
            return new ApiResponse(false, "repository already deleted");
        }

        Singleton.getUniqueDeleteRepoQueue().add(rr);

        return new ApiResponse(true, "repository queued for deletion");
    }, new JsonTransformer());

    get("/api/repo/list/", "application/json", (request, response) -> {
        boolean apiEnabled = Boolean
                .parseBoolean(Properties.getProperties().getProperty("api_enabled", "false"));
        boolean apiAuth = Boolean
                .parseBoolean(Properties.getProperties().getProperty("api_key_authentication", "true"));

        if (!apiEnabled) {
            return new ApiResponse(false, "API not enabled");
        }

        String publicKey = request.queryParams("pub");
        String signedKey = request.queryParams("sig");

        if (apiAuth) {
            if (publicKey == null || publicKey.trim().equals(Values.EMPTYSTRING)) {
                return new ApiResponse(false, "pub is a required parameter");
            }

            if (signedKey == null || signedKey.trim().equals(Values.EMPTYSTRING)) {
                return new ApiResponse(false, "sig is a required parameter");
            }

            String toValidate = String.format("pub=%s", URLEncoder.encode(publicKey));

            boolean validRequest = apiService.validateRequest(publicKey, signedKey, toValidate);

            if (!validRequest) {
                return new ApiResponse(false, "invalid signed url");
            }
        }

        List<RepoResult> repoResultList = repo.getAllRepo();

        return new RepoResultApiResponse(true, Values.EMPTYSTRING, repoResultList);
    }, new JsonTransformer());

    get("/admin/", (request, response) -> {
        if (getAuthenticatedUser(request) == null) {
            response.redirect("/login/");
            halt();
            return null;
        }

        CodeSearcher cs = new CodeSearcher();

        Map<String, Object> map = new HashMap<>();

        map.put("repoCount", repo.getRepoCount());
        map.put("numDocs", cs.getTotalNumberDocumentsIndexed());

        map.put("numSearches", statsService.getSearchCount());
        map.put("uptime", statsService.getUptime());

        // Put all properties here
        map.put(Values.SQLITEFILE,
                Properties.getProperties().getProperty(Values.SQLITEFILE, Values.DEFAULTSQLITEFILE));
        map.put(Values.SERVERPORT,
                Properties.getProperties().getProperty(Values.SERVERPORT, Values.DEFAULTSERVERPORT));
        map.put(Values.REPOSITORYLOCATION, Properties.getProperties().getProperty(Values.REPOSITORYLOCATION,
                Values.DEFAULTREPOSITORYLOCATION));
        map.put(Values.INDEXLOCATION,
                Properties.getProperties().getProperty(Values.INDEXLOCATION, Values.DEFAULTINDEXLOCATION));
        map.put(Values.FACETSLOCATION,
                Properties.getProperties().getProperty(Values.FACETSLOCATION, Values.DEFAULTFACETSLOCATION));
        map.put(Values.CHECKREPOCHANGES, Properties.getProperties().getProperty(Values.CHECKREPOCHANGES,
                Values.DEFAULTCHECKREPOCHANGES));
        map.put(Values.ONLYLOCALHOST,
                Properties.getProperties().getProperty(Values.ONLYLOCALHOST, Values.DEFAULTONLYLOCALHOST));
        map.put(Values.LOWMEMORY,
                Properties.getProperties().getProperty(Values.LOWMEMORY, Values.DEFAULTLOWMEMORY));
        map.put(Values.SPELLINGCORRECTORSIZE, Properties.getProperties()
                .getProperty(Values.SPELLINGCORRECTORSIZE, Values.DEFAULTSPELLINGCORRECTORSIZE));
        map.put(Values.USESYSTEMGIT,
                Properties.getProperties().getProperty(Values.USESYSTEMGIT, Values.DEFAULTUSESYSTEMGIT));
        map.put(Values.GITBINARYPATH,
                Properties.getProperties().getProperty(Values.GITBINARYPATH, Values.DEFAULTGITBINARYPATH));
        map.put(Values.APIENABLED,
                Properties.getProperties().getProperty(Values.APIENABLED, Values.DEFAULTAPIENABLED));
        map.put(Values.APIKEYAUTH,
                Properties.getProperties().getProperty(Values.APIKEYAUTH, Values.DEFAULTAPIKEYAUTH));
        map.put(Values.SVNBINARYPATH,
                Properties.getProperties().getProperty(Values.SVNBINARYPATH, Values.DEFAULTSVNBINARYPATH));
        map.put(Values.SVNENABLED,
                Properties.getProperties().getProperty(Values.SVNENABLED, Values.DEFAULTSVNENABLED));
        map.put(Values.MAXDOCUMENTQUEUESIZE, Properties.getProperties().getProperty(Values.MAXDOCUMENTQUEUESIZE,
                Values.DEFAULTMAXDOCUMENTQUEUESIZE));
        map.put(Values.MAXDOCUMENTQUEUELINESIZE, Properties.getProperties()
                .getProperty(Values.MAXDOCUMENTQUEUELINESIZE, Values.DEFAULTMAXDOCUMENTQUEUELINESIZE));
        map.put(Values.MAXFILELINEDEPTH, Properties.getProperties().getProperty(Values.MAXFILELINEDEPTH,
                Values.DEFAULTMAXFILELINEDEPTH));

        map.put("deletionQueue", Singleton.getUniqueDeleteRepoQueue().size());

        map.put("version", VERSION);

        map.put("logoImage", getLogo());
        map.put("isCommunity", ISCOMMUNITY);
        return new ModelAndView(map, "admin.ftl");
    }, new FreeMarkerEngine());

    get("/admin/repo/", (request, response) -> {
        if (getAuthenticatedUser(request) == null) {
            response.redirect("/login/");
            halt();
            return null;
        }

        int repoCount = repo.getRepoCount();
        String offSet = request.queryParams("offset");
        String searchQuery = request.queryParams("q");
        int indexOffset = 0;

        Map<String, Object> map = new HashMap<>();

        if (offSet != null) {
            try {
                indexOffset = Integer.parseInt(offSet);
                if (indexOffset > repoCount || indexOffset < 0) {
                    indexOffset = 0;
                }

            } catch (NumberFormatException ex) {
                indexOffset = 0;
            }
        }

        if (searchQuery != null) {
            map.put("repoResults", repo.searchRepo(searchQuery));
        } else {
            map.put("repoResults", repo.getPagedRepo(indexOffset, 100));
        }

        map.put("searchQuery", searchQuery);
        map.put("hasPrevious", indexOffset > 0);
        map.put("hasNext", (indexOffset + 100) < repoCount);
        map.put("previousOffset", "" + (indexOffset - 100));
        map.put("nextOffset", "" + (indexOffset + 100));

        map.put("logoImage", getLogo());
        map.put("isCommunity", ISCOMMUNITY);
        return new ModelAndView(map, "admin_repo.ftl");
    }, new FreeMarkerEngine());

    get("/admin/bulk/", (request, response) -> {
        if (getAuthenticatedUser(request) == null) {
            response.redirect("/login/");
            halt();
            return null;
        }

        Map<String, Object> map = new HashMap<>();

        map.put("logoImage", getLogo());
        map.put("isCommunity", ISCOMMUNITY);
        return new ModelAndView(map, "admin_bulk.ftl");
    }, new FreeMarkerEngine());

    get("/admin/api/", (request, response) -> {
        if (getAuthenticatedUser(request) == null) {
            response.redirect("/login/");
            halt();
            return null;
        }

        Map<String, Object> map = new HashMap<>();

        map.put("apiKeys", api.getAllApi());

        boolean apiEnabled = Boolean
                .parseBoolean(Properties.getProperties().getProperty("api_enabled", "false"));
        boolean apiAuth = Boolean
                .parseBoolean(Properties.getProperties().getProperty("api_key_authentication", "true"));

        map.put("apiAuthentication", apiEnabled && apiAuth);
        map.put("logoImage", getLogo());
        map.put("isCommunity", ISCOMMUNITY);
        return new ModelAndView(map, "admin_api.ftl");
    }, new FreeMarkerEngine());

    post("/admin/api/", (request, response) -> {
        if (getAuthenticatedUser(request) == null) {
            response.redirect("/login/");
            halt();
            return null;
        }

        apiService.createKeys();

        response.redirect("/admin/api/");
        halt();
        return null;
    }, new FreeMarkerEngine());

    get("/admin/api/delete/", "application/json", (request, response) -> {
        if (getAuthenticatedUser(request) == null || !request.queryParams().contains("publicKey")) {
            response.redirect("/login/");
            halt();
            return false;
        }

        String publicKey = request.queryParams("publicKey");
        apiService.deleteKey(publicKey);

        return true;
    }, new JsonTransformer());

    get("/admin/settings/", (request, response) -> {
        if (getAuthenticatedUser(request) == null) {
            response.redirect("/login/");
            halt();
            return null;
        }

        String[] highlighters = "agate,androidstudio,arta,ascetic,atelier-cave.dark,atelier-cave.light,atelier-dune.dark,atelier-dune.light,atelier-estuary.dark,atelier-estuary.light,atelier-forest.dark,atelier-forest.light,atelier-heath.dark,atelier-heath.light,atelier-lakeside.dark,atelier-lakeside.light,atelier-plateau.dark,atelier-plateau.light,atelier-savanna.dark,atelier-savanna.light,atelier-seaside.dark,atelier-seaside.light,atelier-sulphurpool.dark,atelier-sulphurpool.light,brown_paper,codepen-embed,color-brewer,dark,darkula,default,docco,far,foundation,github-gist,github,googlecode,grayscale,hopscotch,hybrid,idea,ir_black,kimbie.dark,kimbie.light,magula,mono-blue,monokai,monokai_sublime,obsidian,paraiso.dark,paraiso.light,pojoaque,railscasts,rainbow,school_book,solarized_dark,solarized_light,sunburst,tomorrow-night-blue,tomorrow-night-bright,tomorrow-night-eighties,tomorrow-night,tomorrow,vs,xcode,zenburn"
                .split(",");

        Map<String, Object> map = new HashMap<>();
        map.put("logoImage", getLogo());
        map.put("syntaxHighlighter", getSyntaxHighlighter());
        map.put("highlighters", highlighters);
        map.put("averageSalary", "" + (int) getAverageSalary());
        map.put("matchLines", "" + (int) getMatchLines());
        map.put("maxLineDepth", "" + (int) getMaxLineDepth());
        map.put("minifiedLength", "" + (int) getMinifiedLength());
        map.put("isCommunity", ISCOMMUNITY);

        return new ModelAndView(map, "admin_settings.ftl");
    }, new FreeMarkerEngine());

    get("/admin/reports/", (request, response) -> {
        if (getAuthenticatedUser(request) == null) {
            response.redirect("/login/");
            halt();
            return null;
        }

        Map<String, Object> map = new HashMap<>();
        map.put("logoImage", getLogo());
        map.put("isCommunity", ISCOMMUNITY);

        return new ModelAndView(map, "admin_reports.ftl");
    }, new FreeMarkerEngine());

    post("/admin/settings/", (request, response) -> {
        if (getAuthenticatedUser(request) == null) {
            response.redirect("/login/");
            halt();
            return null;
        }

        if (ISCOMMUNITY) {
            response.redirect("/admin/settings/");
            halt();
        }

        String logo = request.queryParams("logo").trim();
        String syntaxHighlighter = request.queryParams("syntaxhighligher");

        try {
            double averageSalary = Double.parseDouble(request.queryParams("averagesalary"));
            data.saveData(Values.AVERAGESALARY, "" + (int) averageSalary);
        } catch (NumberFormatException ex) {
            data.saveData(Values.AVERAGESALARY, Values.DEFAULTAVERAGESALARY);
        }

        try {
            double averageSalary = Double.parseDouble(request.queryParams("matchlines"));
            data.saveData(Values.MATCHLINES, "" + (int) averageSalary);
        } catch (NumberFormatException ex) {
            data.saveData(Values.MATCHLINES, Values.DEFAULTMATCHLINES);
        }

        try {
            double averageSalary = Double.parseDouble(request.queryParams("maxlinedepth"));
            data.saveData(Values.MAXLINEDEPTH, "" + (int) averageSalary);
        } catch (NumberFormatException ex) {
            data.saveData(Values.MAXLINEDEPTH, Values.DEFAULTMAXLINEDEPTH);
        }

        try {
            double minifiedlength = Double.parseDouble(request.queryParams("minifiedlength"));
            data.saveData(Values.MINIFIEDLENGTH, "" + (int) minifiedlength);
        } catch (NumberFormatException ex) {
            data.saveData(Values.MINIFIEDLENGTH, Values.DEFAULTMINIFIEDLENGTH);
        }

        data.saveData(Values.LOGO, logo);
        data.saveData(Values.SYNTAXHIGHLIGHTER, syntaxHighlighter);

        // Redo anything that requires updates at this point
        scl = Singleton.getSearchcodeLib(data);

        response.redirect("/admin/settings/");
        halt();
        return null;
    }, new FreeMarkerEngine());

    post("/admin/bulk/", (request, response) -> {
        if (getAuthenticatedUser(request) == null) {
            response.redirect("/login/");
            halt();
            return null;
        }

        String repos = request.queryParams("repos");
        String repolines[] = repos.split("\\r?\\n");

        for (String line : repolines) {
            String[] repoparams = line.split(",", -1);

            if (repoparams.length == 7) {

                String branch = repoparams[6].trim();
                if (branch.equals(Values.EMPTYSTRING)) {
                    branch = "master";
                }

                String scm = repoparams[1].trim().toLowerCase();
                if (scm.equals(Values.EMPTYSTRING)) {
                    scm = "git";
                }

                RepoResult rr = repo.getRepoByName(repoparams[0]);

                if (rr == null) {
                    repo.saveRepo(new RepoResult(-1, repoparams[0], scm, repoparams[2], repoparams[3],
                            repoparams[4], repoparams[5], branch));
                }
            }
        }

        response.redirect("/admin/bulk/");
        halt();
        return null;
    }, new FreeMarkerEngine());

    post("/admin/repo/", (request, response) -> {
        if (getAuthenticatedUser(request) == null) {
            response.redirect("/login/");
            halt();
            return null;
        }

        String[] reponames = request.queryParamsValues("reponame");
        String[] reposcms = request.queryParamsValues("reposcm");
        String[] repourls = request.queryParamsValues("repourl");
        String[] repousername = request.queryParamsValues("repousername");
        String[] repopassword = request.queryParamsValues("repopassword");
        String[] reposource = request.queryParamsValues("reposource");
        String[] repobranch = request.queryParamsValues("repobranch");

        for (int i = 0; i < reponames.length; i++) {
            if (reponames[i].trim().length() != 0) {

                String branch = repobranch[i].trim();
                if (branch.equals(Values.EMPTYSTRING)) {
                    branch = "master";
                }

                repo.saveRepo(new RepoResult(-1, reponames[i], reposcms[i], repourls[i], repousername[i],
                        repopassword[i], reposource[i], branch));
            }
        }

        response.redirect("/admin/repo/");
        halt();
        return null;
    }, new FreeMarkerEngine());

    get("/login/", (request, response) -> {
        if (getAuthenticatedUser(request) != null) {
            response.redirect("/admin/");
            halt();
            return null;
        }
        Map<String, Object> map = new HashMap<>();
        map.put("logoImage", getLogo());
        map.put("isCommunity", ISCOMMUNITY);
        return new ModelAndView(map, "login.ftl");
    }, new FreeMarkerEngine());

    post("/login/", (req, res) -> {
        if (req.queryParams().contains("password") && req.queryParams("password")
                .equals(com.searchcode.app.util.Properties.getProperties().getProperty("password"))) {
            addAuthenticatedUser(req);
            res.redirect("/admin/");
            halt();
        }
        Map<String, Object> map = new HashMap<>();
        map.put("logoImage", getLogo());
        map.put("isCommunity", ISCOMMUNITY);
        return new ModelAndView(map, "login.ftl");
    }, new FreeMarkerEngine());

    get("/logout/", (req, res) -> {
        removeAuthenticatedUser(req);
        res.redirect("/");
        return null;
    });

    get("/admin/delete/", "application/json", (request, response) -> {
        if (getAuthenticatedUser(request) == null || !request.queryParams().contains("repoName")) {
            response.redirect("/login/");
            halt();
            return false;
        }

        String repoName = request.queryParams("repoName");
        RepoResult rr = repo.getRepoByName(repoName);

        if (rr != null) {
            Singleton.getUniqueDeleteRepoQueue().add(rr);
        }

        return true;
    }, new JsonTransformer());

    get("/admin/checkversion/", "application/json", (request, response) -> {
        if (getAuthenticatedUser(request) == null) {
            response.redirect("/login/");
            halt();
            return false;
        }

        String version;
        try {
            version = IOUtils.toString(new URL("https://searchcode.com/product/version/")).replace("\"",
                    Values.EMPTYSTRING);
        } catch (IOException ex) {
            return "Unable to determine if running the latest version. Check https://searchcode.com/product/download/ for the latest release.";
        }

        if (App.VERSION.equals(version)) {
            return "Your searchcode server version " + version + " is the latest.";
        } else {
            return "Your searchcode server version " + App.VERSION
                    + " instance is out of date. The latest version is " + version + ".";
        }
    }, new JsonTransformer());

    get("/file/:codeid/:reponame/*", (request, response) -> {
        Map<String, Object> map = new HashMap<>();

        CodeSearcher cs = new CodeSearcher();
        Cocomo2 coco = new Cocomo2();

        StringBuilder code = new StringBuilder();

        String fileName = Values.EMPTYSTRING;
        if (request.splat().length != 0) {
            fileName = request.splat()[0];
        }

        CodeResult codeResult = cs.getByRepoFileName(request.params(":reponame"), fileName);

        if (codeResult == null) {
            int codeid = Integer.parseInt(request.params(":codeid"));
            codeResult = cs.getById(codeid);
        }

        if (codeResult == null) {
            response.redirect("/404/");
            halt();
        }

        List<String> codeLines = codeResult.code;
        for (int i = 0; i < codeLines.size(); i++) {
            code.append("<span id=\"" + (i + 1) + "\"></span>");
            code.append(StringEscapeUtils.escapeHtml4(codeLines.get(i)));
            code.append("\n");
        }

        boolean highlight = true;
        if (Integer.parseInt(codeResult.codeLines) > 1000) {
            highlight = false;
        }

        RepoResult repoResult = repo.getRepoByName(codeResult.repoName);

        if (repoResult != null) {
            map.put("source", repoResult.getSource());
        }

        map.put("fileName", codeResult.fileName);
        map.put("codePath", codeResult.codePath);
        map.put("codeLength", codeResult.codeLines);
        map.put("languageName", codeResult.languageName);
        map.put("md5Hash", codeResult.md5hash);
        map.put("repoName", codeResult.repoName);
        map.put("highlight", highlight);
        map.put("repoLocation", codeResult.getRepoLocation());

        map.put("codeValue", code.toString());
        map.put("highligher", getSyntaxHighlighter());
        map.put("codeOwner", codeResult.getCodeOwner());

        double estimatedEffort = coco.estimateEffort(scl.countFilteredLines(codeResult.getCode()));
        int estimatedCost = (int) coco.estimateCost(estimatedEffort, getAverageSalary());
        if (estimatedCost != 0 && !scl.languageCostIgnore(codeResult.getLanguageName())) {
            map.put("estimatedCost", estimatedCost);
        }

        map.put("logoImage", getLogo());
        map.put("isCommunity", ISCOMMUNITY);
        return new ModelAndView(map, "coderesult.ftl");
    }, new FreeMarkerEngine());

    /**
     * Deprecated should not be used
     * TODO delete this method
     */
    get("/codesearch/view/:codeid", (request, response) -> {
        Map<String, Object> map = new HashMap<>();

        int codeid = Integer.parseInt(request.params(":codeid"));
        CodeSearcher cs = new CodeSearcher();
        Cocomo2 coco = new Cocomo2();

        StringBuilder code = new StringBuilder();

        // escape all the lines and include deeplink for line number
        CodeResult codeResult = cs.getById(codeid);

        if (codeResult == null) {
            response.redirect("/404/");
            halt();
        }

        List<String> codeLines = codeResult.code;
        for (int i = 0; i < codeLines.size(); i++) {
            code.append("<span id=\"" + (i + 1) + "\"></span>");
            code.append(StringEscapeUtils.escapeHtml4(codeLines.get(i)));
            code.append("\n");
        }

        boolean highlight = true;
        if (Integer.parseInt(codeResult.codeLines) > 1000) {
            highlight = false;
        }

        RepoResult repoResult = repo.getRepoByName(codeResult.repoName);

        if (repoResult != null) {
            map.put("source", repoResult.getSource());
        }

        map.put("fileName", codeResult.fileName);
        map.put("codePath", codeResult.codePath);
        map.put("codeLength", codeResult.codeLines);
        map.put("languageName", codeResult.languageName);
        map.put("md5Hash", codeResult.md5hash);
        map.put("repoName", codeResult.repoName);
        map.put("highlight", highlight);
        map.put("repoLocation", codeResult.getRepoLocation());

        map.put("codeValue", code.toString());
        map.put("highligher", getSyntaxHighlighter());
        map.put("codeOwner", codeResult.getCodeOwner());

        double estimatedEffort = coco.estimateEffort(scl.countFilteredLines(codeResult.getCode()));
        int estimatedCost = (int) coco.estimateCost(estimatedEffort, getAverageSalary());
        if (estimatedCost != 0 && !scl.languageCostIgnore(codeResult.getLanguageName())) {
            map.put("estimatedCost", estimatedCost);
        }

        map.put("logoImage", getLogo());
        map.put("isCommunity", ISCOMMUNITY);
        return new ModelAndView(map, "coderesult.ftl");
    }, new FreeMarkerEngine());

    get("/documentation/", (request, response) -> {
        Map<String, Object> map = new HashMap<>();

        map.put("logoImage", getLogo());
        map.put("isCommunity", ISCOMMUNITY);
        return new ModelAndView(map, "documentation.ftl");
    }, new FreeMarkerEngine());

    get("/search_test/", (request, response) -> {
        Map<String, Object> map = new HashMap<>();

        map.put("logoImage", getLogo());
        map.put("isCommunity", ISCOMMUNITY);
        return new ModelAndView(map, "search_test.ftl");
    }, new FreeMarkerEngine());

    get("/404/", (request, response) -> {
        Map<String, Object> map = new HashMap<>();

        map.put("logoImage", getLogo());
        map.put("isCommunity", ISCOMMUNITY);
        return new ModelAndView(map, "404.ftl");

    }, new FreeMarkerEngine());

    /**
     * Test that was being used to display blame information
     */
    //        get("/test/:reponame/*", (request, response) -> {
    //            User user = injector.getInstance(User.class);
    //            user.Blame(request.params(":reponame"), request.splat()[0]);
    //            return "";
    //        }, new JsonTransformer());
}

From source file:org.silverpeas.dbbuilder.DBBuilder.java

/**
 * @param args/*from   w  ww  .j  ava 2 s  .  c o  m*/
 * @see
 */
public static void main(String[] args) {
    ClassPathXmlApplicationContext springContext = new ClassPathXmlApplicationContext(
            "classpath:/spring-jdbc-datasource.xml");
    try {
        // Ouverture des traces
        Date startDate = new Date();
        System.out.println(
                MessageFormat.format(messages.getString("dbbuilder.start"), DBBuilderAppVersion, startDate));
        console = new Console(DBBuilder.class);
        console.printMessage("*************************************************************");
        console.printMessage(
                MessageFormat.format(messages.getString("dbbuilder.start"), DBBuilderAppVersion, startDate));
        // Lecture des variables d'environnement  partir de dbBuilderSettings
        dbBuilderResources = FileUtil
                .loadResource("/org/silverpeas/dbBuilder/settings/dbBuilderSettings.properties");
        // Lecture des paramtres d'entre
        params = new CommandLineParameters(console, args);

        if (params.isSimulate() && DatabaseType.ORACLE == params.getDbType()) {
            throw new Exception(messages.getString("oracle.simulate.error"));
        }
        console.printMessage(messages.getString("jdbc.connection.configuration"));
        console.printMessage(ConnectionFactory.getConnectionInfo());
        console.printMessage("\tAction        : " + params.getAction());
        console.printMessage("\tVerbose mode  : " + params.isVerbose());
        console.printMessage("\tSimulate mode : " + params.isSimulate());
        if (Action.ACTION_CONNECT == params.getAction()) {
            // un petit message et puis c'est tout
            console.printMessage(messages.getString("connection.success"));
            System.out.println(messages.getString("connection.success"));
        } else {
            // Modules en place sur la BD avant install
            console.printMessage("DB Status before build :");
            List<String> packagesIntoDB = checkDBStatus();
            // initialisation d'un vecteur des instructions SQL  passer en fin d'upgrade
            // pour mettre  niveau les versions de modules en base
            MetaInstructions sqlMetaInstructions = new MetaInstructions();
            File dirXml = new File(params.getDbType().getDBContributionDir());
            DBXmlDocument destXml = loadMasterContribution(dirXml);
            UninstallInformations processesToCacheIntoDB = new UninstallInformations();

            File[] listeFileXml = dirXml.listFiles();
            Arrays.sort(listeFileXml);

            List<DBXmlDocument> listeDBXmlDocument = new ArrayList<DBXmlDocument>(listeFileXml.length);
            int ignoredFiles = 0;
            // Ouverture de tous les fichiers de configurations
            console.printMessage(messages.getString("ignored.contribution"));

            for (File xmlFile : listeFileXml) {
                if (xmlFile.isFile() && "xml".equals(FileUtil.getExtension(xmlFile))
                        && !(FIRST_DBCONTRIBUTION_FILE.equalsIgnoreCase(xmlFile.getName()))
                        && !(MASTER_DBCONTRIBUTION_FILE.equalsIgnoreCase(xmlFile.getName()))) {
                    DBXmlDocument fXml = new DBXmlDocument(dirXml, xmlFile.getName());
                    fXml.load();
                    // vrification des dpendances et prise en compte uniquement si dependences OK
                    if (hasUnresolvedRequirements(listeFileXml, fXml)) {
                        console.printMessage(
                                '\t' + xmlFile.getName() + " (because of unresolved requirements).");
                        ignoredFiles++;
                    } else if (ACTION_ENFORCE_UNINSTALL == params.getAction()) {
                        console.printMessage('\t' + xmlFile.getName() + " (because of "
                                + ACTION_ENFORCE_UNINSTALL + " mode).");
                        ignoredFiles++;
                    } else {
                        listeDBXmlDocument.add(fXml);
                    }
                }
            }
            if (0 == ignoredFiles) {
                console.printMessage("\t(none)");
            }

            // prpare une HashMap des modules prsents en fichiers de contribution
            Map packagesIntoFile = new HashMap();
            int j = 0;
            console.printMessage(messages.getString("merged.contribution"));
            console.printMessage(params.getAction().toString());
            if (ACTION_ENFORCE_UNINSTALL != params.getAction()) {
                console.printMessage('\t' + FIRST_DBCONTRIBUTION_FILE);
                j++;
            }
            for (DBXmlDocument currentDoc : listeDBXmlDocument) {
                console.printMessage('\t' + currentDoc.getName());
                j++;
            }
            if (0 == j) {
                console.printMessage("\t(none)");
            }
            // merge des diffrents fichiers de contribution ligibles :
            console.printMessage("Build decisions are :");
            // d'abord le fichier dbbuilder-contribution ...
            DBXmlDocument fileXml;
            if (ACTION_ENFORCE_UNINSTALL != params.getAction()) {
                try {
                    fileXml = new DBXmlDocument(dirXml, FIRST_DBCONTRIBUTION_FILE);
                    fileXml.load();
                } catch (Exception e) {
                    // contribution de dbbuilder non trouve -> on continue, on est certainement en train
                    // de desinstaller la totale
                    fileXml = null;
                }
                if (null != fileXml) {
                    DBBuilderFileItem dbbuilderItem = new DBBuilderFileItem(fileXml);
                    packagesIntoFile.put(dbbuilderItem.getModule(), null);
                    mergeActionsToDo(dbbuilderItem, destXml, processesToCacheIntoDB, sqlMetaInstructions);
                }
            }

            // ... puis les autres
            for (DBXmlDocument currentDoc : listeDBXmlDocument) {
                DBBuilderFileItem tmpdbbuilderItem = new DBBuilderFileItem(currentDoc);
                packagesIntoFile.put(tmpdbbuilderItem.getModule(), null);
                mergeActionsToDo(tmpdbbuilderItem, destXml, processesToCacheIntoDB, sqlMetaInstructions);
            }

            // ... et enfin les pices BD  dsinstaller
            // ... attention, l'ordonnancement n'tant pas dispo, on les traite dans
            // l'ordre inverse pour faire passer busCore a la fin, de nombreuses contraintes
            // des autres modules referencant les PK de busCore
            List<String> itemsList = new ArrayList<String>();

            boolean foundDBBuilder = false;
            for (String dbPackage : packagesIntoDB) {
                if (!packagesIntoFile.containsKey(dbPackage)) {
                    // Package en base et non en contribution -> candidat  desinstallation
                    if (DBBUILDER_MODULE.equalsIgnoreCase(dbPackage)) {
                        foundDBBuilder = true;
                    } else if (ACTION_ENFORCE_UNINSTALL == params.getAction()) {
                        if (dbPackage.equals(params.getModuleName())) {
                            itemsList.add(0, dbPackage);
                        }
                    } else {
                        itemsList.add(0, dbPackage);
                    }
                }
            }

            if (foundDBBuilder) {
                if (ACTION_ENFORCE_UNINSTALL == params.getAction()) {
                    if (DBBUILDER_MODULE.equals(params.getModuleName())) {
                        itemsList.add(itemsList.size(), DBBUILDER_MODULE);
                    }
                } else {
                    itemsList.add(itemsList.size(), DBBUILDER_MODULE);
                }
            }
            for (String item : itemsList) {
                console.printMessage("**** Treating " + item + " ****");
                DBBuilderDBItem tmpdbbuilderItem = new DBBuilderDBItem(item);
                mergeActionsToDo(tmpdbbuilderItem, destXml, processesToCacheIntoDB, sqlMetaInstructions);
            }
            destXml.setName("res.txt");
            destXml.save();
            console.printMessage("Build parts are :");
            // Traitement des pices slectionnes
            // remarque : durant cette phase, les erreurs sont traites -> on les catche en
            // retour sans les retraiter
            if (ACTION_INSTALL == params.getAction()) {
                processDB(destXml, processesToCacheIntoDB, sqlMetaInstructions, TAGS_TO_MERGE_4_INSTALL);
            } else if (ACTION_UNINSTALL == params.getAction()
                    || ACTION_ENFORCE_UNINSTALL == params.getAction()) {
                processDB(destXml, processesToCacheIntoDB, sqlMetaInstructions, TAGS_TO_MERGE_4_UNINSTALL);
            } else if (ACTION_OPTIMIZE == params.getAction()) {
                processDB(destXml, processesToCacheIntoDB, sqlMetaInstructions, TAGS_TO_MERGE_4_OPTIMIZE);
            } else if (ACTION_ALL == params.getAction()) {
                processDB(destXml, processesToCacheIntoDB, sqlMetaInstructions, TAGS_TO_MERGE_4_ALL);
            }
            // Modules en place sur la BD en final
            console.printMessage("Finally DB Status :");
            checkDBStatus();
        }
        Date endDate = new Date();
        console.printMessage(MessageFormat.format(messages.getString("dbbuilder.success"), endDate));
        System.out.println("*******************************************************************");
        System.out.println(MessageFormat.format(messages.getString("dbbuilder.success"), endDate));
    } catch (Exception e) {
        e.printStackTrace();
        console.printError(e.getMessage(), e);
        Date endDate = new Date();
        console.printError(MessageFormat.format(messages.getString("dbbuilder.failure"), endDate));
        System.out.println("*******************************************************************");
        System.out.println(MessageFormat.format(messages.getString("dbbuilder.failure"), endDate));
        System.exit(1);
    } finally {
        springContext.close();
        console.close();
    }
}

From source file:com.curecomp.primefaces.migrator.PrimefacesMigration.java

public static void main(String[] args) throws Exception {
    // Let's use some colors :)
    //        AnsiConsole.systemInstall();
    CommandLineParser cliParser = new BasicParser();
    CommandLine cli = null;// w w w  . j  a  v a2s .c  o  m
    try {
        cli = cliParser.parse(OPTIONS, args);
    } catch (ParseException e) {
        printHelp();
    }
    if (!cli.hasOption("s")) {
        printHelp();
    }

    String sourcePattern;
    if (cli.hasOption("p")) {
        sourcePattern = cli.getOptionValue("p");
    } else {
        sourcePattern = DEFAULT_SOURCE_PATTERN;
    }

    String defaultAnswer;
    if (cli.hasOption("default-answer")) {
        defaultAnswer = cli.getOptionValue("default-answer");
    } else {
        defaultAnswer = DEFAULT_DEFAULT_PROMPT_ANSWER;
    }

    boolean defaultAnswerYes = defaultAnswer.equalsIgnoreCase("y");
    boolean quiet = cli.hasOption("q");
    boolean testWrite = cli.hasOption("t");
    Path sourceDirectory = Paths.get(cli.getOptionValue("s")).toAbsolutePath();
    // Since we use IO we will have some blocking threads hanging around
    int threadCount = Runtime.getRuntime().availableProcessors() * 2;
    ThreadPoolExecutor threadPool = new ThreadPoolExecutor(threadCount, threadCount, 0L, TimeUnit.MILLISECONDS,
            new LinkedBlockingQueue<>());
    BlockingQueue<WidgetVarLocation> foundUsages = new LinkedBlockingQueue<>();
    BlockingQueue<WidgetVarLocation> unusedOrAmbiguous = new LinkedBlockingQueue<>();
    BlockingQueue<WidgetVarLocation> skippedUsages = new LinkedBlockingQueue<>();
    List<Future<?>> futures = new ArrayList<>();

    findWidgetVars(sourceDirectory, sourcePattern, threadPool).forEach(widgetVarLocation -> {
        // We can't really find usages of widget vars that use EL expressions :(
        if (widgetVarLocation.widgetVar.contains("#")) {
            unusedOrAmbiguous.add(widgetVarLocation);
            return;
        }

        try {
            FileActionVisitor visitor = new FileActionVisitor(sourceDirectory, sourcePattern,
                    sourceFile -> futures.add(threadPool.submit((Callable<?>) () -> {
                        findWidgetVarUsages(sourceFile, widgetVarLocation, foundUsages, skippedUsages,
                                unusedOrAmbiguous);
                        return null;
                    })));

            Files.walkFileTree(sourceDirectory, visitor);
        } catch (IOException ex) {
            throw new RuntimeException(ex);
        }
    });

    awaitAll(futures);

    new TreeSet<>(skippedUsages).forEach(widgetUsage -> {
        int startIndex = widgetUsage.columnNr;
        int endIndex = startIndex + widgetUsage.widgetVar.length();
        String relativePath = widgetUsage.location.toAbsolutePath().toString()
                .substring(sourceDirectory.toString().length());
        String previous = replace(widgetUsage.line, startIndex, endIndex,
                Ansi.ansi().bold().fg(Ansi.Color.RED).a(widgetUsage.widgetVar).reset().toString());
        System.out.println("Skipped " + relativePath + " at line " + widgetUsage.lineNr + " and col "
                + widgetUsage.columnNr + " for widgetVar '" + widgetUsage.widgetVar + "'");
        System.out.println("\t" + previous);
    });

    Map<WidgetVarLocation, List<WidgetVarLocation>> written = new HashMap<>();

    new TreeSet<>(foundUsages).forEach(widgetUsage -> {
        WidgetVarLocation key = new WidgetVarLocation(null, widgetUsage.location, widgetUsage.lineNr, -1, null);
        List<WidgetVarLocation> writtenList = written.get(key);
        int existing = writtenList == null ? 0 : writtenList.size();
        int startIndex = widgetUsage.columnNr;
        int endIndex = startIndex + widgetUsage.widgetVar.length();
        String relativePath = widgetUsage.location.toAbsolutePath().toString()
                .substring(sourceDirectory.toString().length());
        String next = replace(widgetUsage.line, startIndex, endIndex, Ansi.ansi().bold().fg(Ansi.Color.RED)
                .a("PF('" + widgetUsage.widgetVar + "')").reset().toString());
        System.out
                .println(relativePath + " at line " + widgetUsage.lineNr + " and col " + widgetUsage.columnNr);
        System.out.println("\t" + next);
        System.out.print("Replace (Y/N)? [" + (defaultAnswerYes ? "Y" : "N") + "]: ");

        String input;

        if (quiet) {
            input = "";
            System.out.println();
        } else {
            try {
                do {
                    input = in.readLine();
                } while (input != null && !input.isEmpty() && !"y".equalsIgnoreCase(input)
                        && !"n".equalsIgnoreCase(input));
            } catch (IOException ex) {
                throw new RuntimeException(ex);
            }
        }

        if (input == null) {
            System.out.println("Aborted!");
        } else if (input.isEmpty() && defaultAnswerYes || !input.isEmpty() && !"n".equalsIgnoreCase(input)) {
            System.out.println("Replaced!");
            System.out.print("\t");
            if (writtenList == null) {
                writtenList = new ArrayList<>();
                written.put(key, writtenList);
            }

            writtenList.add(widgetUsage);
            List<String> lines;
            try {
                lines = Files.readAllLines(widgetUsage.location);
            } catch (IOException ex) {
                throw new RuntimeException(ex);
            }

            try (OutputStream os = testWrite ? new ByteArrayOutputStream()
                    : Files.newOutputStream(widgetUsage.location);
                    PrintWriter pw = new PrintWriter(new OutputStreamWriter(os, StandardCharsets.UTF_8))) {
                String line;

                for (int i = 0; i < lines.size(); i++) {
                    int lineNr = i + 1;
                    line = lines.get(i);

                    if (lineNr == widgetUsage.lineNr) {
                        int begin = widgetUsage.columnNr + (testWrite ? 0 : existing * 6);
                        int end = begin + widgetUsage.widgetVar.length();
                        String newLine = replace(line, begin, end, "PF('" + widgetUsage.widgetVar + "')",
                                false);

                        if (testWrite) {
                            System.out.println(newLine);
                        } else {
                            pw.println(newLine);
                        }
                    } else {
                        if (!testWrite) {
                            pw.println(line);
                        }
                    }
                }
            } catch (IOException ex) {
                throw new RuntimeException(ex);
            }
        } else {
            System.out.println("Skipped!");
        }
    });

    new TreeSet<>(unusedOrAmbiguous).forEach(widgetUsage -> {
        int startIndex = widgetUsage.columnNr;
        int endIndex = startIndex + widgetUsage.widgetVar.length();
        String relativePath = widgetUsage.location.toAbsolutePath().toString()
                .substring(sourceDirectory.toString().length());
        String previous = replace(widgetUsage.line, startIndex, endIndex,
                Ansi.ansi().bold().fg(Ansi.Color.RED).a(widgetUsage.widgetVar).reset().toString());
        System.out.println("Skipped unused or ambiguous " + relativePath + " at line " + widgetUsage.lineNr
                + " and col " + widgetUsage.columnNr);
        System.out.println("\t" + previous);
    });

    threadPool.shutdown();
}

From source file:com.mch.registry.ccs.server.CcsClient.java

/**
 * Sends messages to registered devices//from   ww w . j av  a  2  s.c  om
 */
public static void main(String[] args) {

    Config config = new Config();
    final String projectId = config.getProjectId();
    final String key = config.getKey();

    final CcsClient ccsClient = CcsClient.prepareClient(projectId, key, true);

    try {
        ccsClient.connect();
    } catch (XMPPException e) {
        logger.log(Level.WARNING, "XMPP Exception ", e);
    }

    final Runnable sendNotifications = new Runnable() {
        public void run() {
            try {
                logger.log(Level.INFO, "Working Q!");
                if (!isOffHours()) {
                    //Prepare downstream message
                    String toRegId = "";
                    String message = "";
                    String messageId = "";
                    Map<String, String> payload = new HashMap<String, String>();
                    String collapseKey = null;
                    Long timeToLive = 10000L;
                    Boolean delayWhileIdle = true;
                    String messagePrefix = "";
                    int notificationQueueID = 0;
                    boolean sucessfullySent = false;

                    //Read from mysql database
                    MySqlHandler mysql = new MySqlHandler();
                    ArrayList<Notification> queue = new ArrayList<Notification>();

                    for (int i = 1; i < 3; i++) {
                        queue = mysql.getNotificationQueue(i);
                        if (queue.size() > 0) {

                            switch (i) {
                            case 1:
                                messagePrefix = "_V: ";
                                break;
                            case 2:
                                messagePrefix = "_R: ";
                                break;
                            default:
                                messagePrefix = "";
                                logger.log(Level.WARNING, "Unknown message type!");
                            }

                            Notification notification = new Notification();
                            Iterator<Notification> iterator = queue.iterator();

                            while (iterator.hasNext()) {
                                notification = iterator.next();

                                toRegId = notification.getGcmRegID();
                                message = notification.getNotificationText();
                                notificationQueueID = notification.getNotificationQueueID();
                                messageId = "m-" + Long.toString(random.nextLong());

                                payload = new HashMap<String, String>();
                                payload.put("message", messagePrefix + message);

                                try {
                                    // Send the downstream message to a device.
                                    ccsClient.send(createJsonMessage(toRegId, messageId, payload, collapseKey,
                                            timeToLive, delayWhileIdle));
                                    sucessfullySent = true;
                                    logger.log(Level.INFO, "Message sent. ID: " + notificationQueueID
                                            + ", RegID: " + toRegId + ", Text: " + message);
                                } catch (Exception e) {
                                    mysql.prepareNotificationForTheNextDay(notificationQueueID);
                                    sucessfullySent = false;
                                    logger.log(Level.WARNING,
                                            "Message could not be sent! ID: " + notificationQueueID
                                                    + ", RegID: " + toRegId + ", Text: " + message);
                                }

                                if (sucessfullySent) {
                                    mysql.moveNotificationToHistory(notificationQueueID);
                                }
                            }
                        } else {
                            logger.log(Level.INFO, "No notifications to send. Type: " + Integer.toString(i));
                        }
                    }
                }
            } catch (Exception e) {
                logger.log(Level.WARNING, "Exception ", e);
            }
        }
    };

    ScheduledExecutorService executor = Executors.newSingleThreadScheduledExecutor();
    //Start when server starts and every 30 minutes after
    ScheduledFuture task = executor.scheduleAtFixedRate(sendNotifications, 0, 30, TimeUnit.MINUTES);
    try {
        task.get();
    } catch (ExecutionException e) {
        logger.log(Level.SEVERE, "Exception ", e);
    } catch (InterruptedException e) {
        logger.log(Level.SEVERE, "Exception ", e);
    }
    task.cancel(false);

    try {
        executor.shutdown();
        executor.awaitTermination(30, TimeUnit.SECONDS);
    } catch (InterruptedException e) {
        logger.log(Level.SEVERE, "Exception ", e);
    }

}

From source file:com.act.lcms.db.analysis.PathwayProductAnalysis.java

public static void main(String[] args) throws Exception {
    Options opts = new Options();
    for (Option.Builder b : OPTION_BUILDERS) {
        opts.addOption(b.build());//from   www .j ava  2 s. c  om
    }

    CommandLine cl = null;
    try {
        CommandLineParser parser = new DefaultParser();
        cl = parser.parse(opts, args);
    } catch (ParseException e) {
        System.err.format("Argument parsing failed: %s\n", e.getMessage());
        HELP_FORMATTER.printHelp(LoadPlateCompositionIntoDB.class.getCanonicalName(), HELP_MESSAGE, opts, null,
                true);
        System.exit(1);
    }

    if (cl.hasOption("help")) {
        HELP_FORMATTER.printHelp(LoadPlateCompositionIntoDB.class.getCanonicalName(), HELP_MESSAGE, opts, null,
                true);
        return;
    }

    File lcmsDir = new File(cl.getOptionValue(OPTION_DIRECTORY));
    if (!lcmsDir.isDirectory()) {
        System.err.format("File at %s is not a directory\n", lcmsDir.getAbsolutePath());
        HELP_FORMATTER.printHelp(LoadPlateCompositionIntoDB.class.getCanonicalName(), HELP_MESSAGE, opts, null,
                true);
        System.exit(1);
    }

    Double fontScale = null;
    if (cl.hasOption("font-scale")) {
        try {
            fontScale = Double.parseDouble(cl.getOptionValue("font-scale"));
        } catch (IllegalArgumentException e) {
            System.err.format("Argument for font-scale must be a floating point number.\n");
            System.exit(1);
        }
    }

    try (DB db = DB.openDBFromCLI(cl)) {
        Set<Integer> takeSamplesFromPlateIds = null;
        if (cl.hasOption(OPTION_FILTER_BY_PLATE_BARCODE)) {
            String[] plateBarcodes = cl.getOptionValues(OPTION_FILTER_BY_PLATE_BARCODE);
            System.out.format("Considering only sample wells in plates: %s\n",
                    StringUtils.join(plateBarcodes, ", "));
            takeSamplesFromPlateIds = new HashSet<>(plateBarcodes.length);
            for (String plateBarcode : plateBarcodes) {
                Plate p = Plate.getPlateByBarcode(db, plateBarcode);
                if (p == null) {
                    System.err.format("WARNING: unable to find plate in DB with barcode %s\n", plateBarcode);
                } else {
                    takeSamplesFromPlateIds.add(p.getId());
                }
            }
            // Allow filtering on barcode even if we couldn't find any in the DB.
        }

        System.out.format("Loading/updating LCMS scan files into DB\n");
        ScanFile.insertOrUpdateScanFilesInDirectory(db, lcmsDir);

        System.out.format("Processing LCMS scans\n");
        Pair<List<LCMSWell>, Set<Integer>> positiveWellsAndPlateIds = Utils.extractWellsAndPlateIds(db,
                cl.getOptionValues(OPTION_STRAINS), cl.getOptionValues(OPTION_CONSTRUCT),
                takeSamplesFromPlateIds, false);
        List<LCMSWell> positiveWells = positiveWellsAndPlateIds.getLeft();
        if (positiveWells.size() == 0) {
            throw new RuntimeException("Found no LCMS wells for specified strains/constructs");
        }
        // Only take negative samples from the plates where we found the positive samples.
        Pair<List<LCMSWell>, Set<Integer>> negativeWellsAndPlateIds = Utils.extractWellsAndPlateIds(db,
                cl.getOptionValues(OPTION_NEGATIVE_STRAINS), cl.getOptionValues(OPTION_NEGATIVE_CONSTRUCTS),
                positiveWellsAndPlateIds.getRight(), true);
        List<LCMSWell> negativeWells = negativeWellsAndPlateIds.getLeft();
        if (negativeWells == null || negativeWells.size() == 0) {
            System.err.format("WARNING: no valid negative samples found in same plates as positive samples\n");
        }

        // Extract the chemicals in the pathway and their product masses, then look up info on those chemicals
        List<Pair<ChemicalAssociatedWithPathway, Double>> productMasses = Utils
                .extractMassesForChemicalsAssociatedWithConstruct(db, cl.getOptionValue(OPTION_CONSTRUCT));
        List<Pair<String, Double>> searchMZs = new ArrayList<>(productMasses.size());
        List<ChemicalAssociatedWithPathway> pathwayChems = new ArrayList<>(productMasses.size());
        for (Pair<ChemicalAssociatedWithPathway, Double> productMass : productMasses) {
            String chemName = productMass.getLeft().getChemical();
            searchMZs.add(Pair.of(chemName, productMass.getRight()));
            pathwayChems.add(productMass.getLeft());
        }
        System.out.format("Searching for intermediate/side-reaction products:\n");
        for (Pair<String, Double> searchMZ : searchMZs) {
            System.out.format("  %s: %.3f\n", searchMZ.getLeft(), searchMZ.getRight());
        }

        // Look up the standard by name.
        List<StandardWell> standardWells = new ArrayList<>();
        if (cl.hasOption(OPTION_STANDARD_WELLS)) {
            Plate standardPlate = Plate.getPlateByBarcode(db, cl.getOptionValue(OPTION_STANDARD_PLATE_BARCODE));
            Map<Integer, StandardWell> pathwayIdToStandardWell = extractStandardWellsFromOptionsList(db,
                    pathwayChems, cl.getOptionValues(OPTION_STANDARD_WELLS), standardPlate);
            for (ChemicalAssociatedWithPathway c : pathwayChems) { // TODO: we can avoid this loop.
                StandardWell well = pathwayIdToStandardWell.get(c.getId());
                if (well != null) {
                    standardWells.add(well);
                }
            }
        } else {
            for (ChemicalAssociatedWithPathway c : pathwayChems) {
                String standardName = c.getChemical();
                System.out.format("Searching for well containing standard %s\n", standardName);
                List<StandardWell> wells = StandardIonAnalysis.getStandardWellsForChemical(db, c.getChemical());
                if (wells != null) {
                    standardWells.addAll(wells);
                }
            }
        }

        boolean useFineGrainedMZ = cl.hasOption("fine-grained-mz");
        boolean useSNR = cl.hasOption(OPTION_USE_SNR);

        /* Process the standard, positive, and negative wells, producing ScanData containers that will allow them to be
         * iterated over for graph writing. We do not need to specify granular includeIons and excludeIons since
         * this would not take advantage of our caching strategy which uses a list of metlin ions as an index. */
        HashMap<Integer, Plate> plateCache = new HashMap<>();
        Pair<List<ScanData<StandardWell>>, Double> allStandardScans = AnalysisHelper.processScans(db, lcmsDir,
                searchMZs, ScanData.KIND.STANDARD, plateCache, standardWells, useFineGrainedMZ, EMPTY_SET,
                EMPTY_SET, useSNR);
        Pair<List<ScanData<LCMSWell>>, Double> allPositiveScans = AnalysisHelper.processScans(db, lcmsDir,
                searchMZs, ScanData.KIND.POS_SAMPLE, plateCache, positiveWells, useFineGrainedMZ, EMPTY_SET,
                EMPTY_SET, useSNR);
        Pair<List<ScanData<LCMSWell>>, Double> allNegativeScans = AnalysisHelper.processScans(db, lcmsDir,
                searchMZs, ScanData.KIND.NEG_CONTROL, plateCache, negativeWells, useFineGrainedMZ, EMPTY_SET,
                EMPTY_SET, useSNR);

        String fmt = "pdf";
        String outImg = cl.getOptionValue(OPTION_OUTPUT_PREFIX) + "." + fmt;
        String outData = cl.getOptionValue(OPTION_OUTPUT_PREFIX) + ".data";
        String outAnalysis = cl.getOptionValue(OPTION_OUTPUT_PREFIX) + ".tsv";

        System.err.format("Writing combined scan data to %s and graphs to %s\n", outData, outImg);
        String plottingDirectory = cl.getOptionValue(OPTION_PLOTTING_DIR);

        List<ScanData<LCMSWell>> posNegWells = new ArrayList<>();
        posNegWells.addAll(allPositiveScans.getLeft());
        posNegWells.addAll(allNegativeScans.getLeft());

        Map<Integer, String> searchIons;
        if (cl.hasOption(OPTION_PATHWAY_SEARCH_IONS)) {
            searchIons = extractPathwayStepIons(pathwayChems, cl.getOptionValues(OPTION_PATHWAY_SEARCH_IONS),
                    cl.getOptionValue(OPTION_SEARCH_ION, "M+H"));
            /* This is pretty lazy, but works with the existing API.  Extract all selected ions for all search masses when
             * performing the scan, then filter down to the desired ions for the plot at the end.
             * TODO: specify the masses and scans per sample rather than batching everything together.  It might be slower,
             * but it'll be clearer to read. */
        } else {
            // We need to make sure that the standard metlin ion we choose is consistent with the ion modes of
            // the given positive, negative and standard scan files. For example, we should not pick a negative
            // metlin ion if all our available positive control scan files are in the positive ion mode.
            Map<Integer, Pair<Boolean, Boolean>> ionModes = new HashMap<>();
            for (ChemicalAssociatedWithPathway chemical : pathwayChems) {
                boolean isPositiveScanPresent = false;
                boolean isNegativeScanPresent = false;

                for (ScanData<StandardWell> scan : allStandardScans.getLeft()) {
                    if (chemical.getChemical().equals(scan.getWell().getChemical())
                            && chemical.getChemical().equals(scan.getTargetChemicalName())) {
                        if (MS1.IonMode.valueOf(
                                scan.getScanFile().getMode().toString().toUpperCase()) == MS1.IonMode.POS) {
                            isPositiveScanPresent = true;
                        }

                        if (MS1.IonMode.valueOf(
                                scan.getScanFile().getMode().toString().toUpperCase()) == MS1.IonMode.NEG) {
                            isNegativeScanPresent = true;
                        }
                    }
                }

                for (ScanData<LCMSWell> scan : posNegWells) {
                    if (chemical.getChemical().equals(scan.getWell().getChemical())
                            && chemical.getChemical().equals(scan.getTargetChemicalName())) {
                        if (MS1.IonMode.valueOf(
                                scan.getScanFile().getMode().toString().toUpperCase()) == MS1.IonMode.POS) {
                            isPositiveScanPresent = true;
                        }

                        if (MS1.IonMode.valueOf(
                                scan.getScanFile().getMode().toString().toUpperCase()) == MS1.IonMode.NEG) {
                            isNegativeScanPresent = true;
                        }
                    }
                }

                ionModes.put(chemical.getId(), Pair.of(isPositiveScanPresent, isNegativeScanPresent));
            }

            // Sort in descending order of media where MeOH and Water related media are promoted to the top and
            // anything derived from yeast media are demoted. We do this because we want to first process the water
            // and meoh media before processing the yeast media since the yeast media depends on the analysis of the former.
            Collections.sort(standardWells, new Comparator<StandardWell>() {
                @Override
                public int compare(StandardWell o1, StandardWell o2) {
                    if (StandardWell.doesMediaContainYeastExtract(o1.getMedia())
                            && !StandardWell.doesMediaContainYeastExtract(o2.getMedia())) {
                        return 1;
                    } else {
                        return 0;
                    }
                }
            });

            searchIons = extractPathwayStepIonsFromStandardIonAnalysis(pathwayChems, lcmsDir, db, standardWells,
                    plottingDirectory, ionModes);
        }

        produceLCMSPathwayHeatmaps(lcmsDir, outData, outImg, outAnalysis, pathwayChems, allStandardScans,
                allPositiveScans, allNegativeScans, fontScale, cl.hasOption(OPTION_USE_HEATMAP), searchIons);
    }
}

From source file:com.github.fritaly.svngraph.SvnGraph.java

public static void main(String[] args) throws Exception {
    if (args.length != 2) {
        System.out.println(String.format("%s <input-file> <output-file>", SvnGraph.class.getSimpleName()));
        System.exit(1);/*from   ww  w . ja  v  a 2  s.c  o m*/
    }

    final File input = new File(args[0]);

    if (!input.exists()) {
        throw new IllegalArgumentException(
                String.format("The given file '%s' doesn't exist", input.getAbsolutePath()));
    }

    final File output = new File(args[1]);

    final Document document = DocumentBuilderFactory.newInstance().newDocumentBuilder().parse(input);

    final History history = new History(document);

    final Set<String> rootPaths = history.getRootPaths();

    System.out.println(rootPaths);

    for (String path : rootPaths) {
        System.out.println(path);
        System.out.println(history.getHistory(path).getRevisions());
        System.out.println();
    }

    int count = 0;

    FileWriter fileWriter = null;
    GraphMLWriter graphWriter = null;

    try {
        fileWriter = new FileWriter(output);

        graphWriter = new GraphMLWriter(fileWriter);

        final NodeStyle tagStyle = graphWriter.getNodeStyle();
        tagStyle.setFillColor(Color.WHITE);

        graphWriter.graph();

        // map associating node labels to their corresponding node id in the graph
        final Map<String, String> nodeIdsPerLabel = new TreeMap<>();

        // the node style associated to each branch
        final Map<String, NodeStyle> nodeStyles = new TreeMap<>();

        for (Revision revision : history.getSignificantRevisions()) {
            System.out.println(revision.getNumber() + " - " + revision.getMessage());

            // TODO Render also the deletion of branches
            // there should be only 1 significant update per revision (the one with action ADD)
            for (Update update : revision.getSignificantUpdates()) {
                if (update.isCopy()) {
                    // a merge is also considered a copy
                    final RevisionPath source = update.getCopySource();

                    System.out.println(String.format("  > %s %s from %s@%d", update.getAction(),
                            update.getPath(), source.getPath(), source.getRevision()));

                    final String sourceRoot = Utils.getRootName(source.getPath());

                    if (sourceRoot == null) {
                        // skip the revisions whose associated root is
                        // null (happens whether a branch was created
                        // outside the 'branches' directory for
                        // instance)
                        System.err.println(String.format("Skipped revision %d because of a null root",
                                source.getRevision()));
                        continue;
                    }

                    final String sourceLabel = computeNodeLabel(sourceRoot, source.getRevision());

                    // create a node for the source (path, revision)
                    final String sourceId;

                    if (nodeIdsPerLabel.containsKey(sourceLabel)) {
                        // retrieve the id of the existing node
                        sourceId = nodeIdsPerLabel.get(sourceLabel);
                    } else {
                        // create the new node
                        if (Utils.isTagPath(source.getPath())) {
                            graphWriter.setNodeStyle(tagStyle);
                        } else {
                            if (!nodeStyles.containsKey(sourceRoot)) {
                                final NodeStyle style = new NodeStyle();
                                style.setFillColor(randomColor());

                                nodeStyles.put(sourceRoot, style);
                            }

                            graphWriter.setNodeStyle(nodeStyles.get(sourceRoot));
                        }

                        sourceId = graphWriter.node(sourceLabel);

                        nodeIdsPerLabel.put(sourceLabel, sourceId);
                    }

                    // and another for the newly created directory
                    final String targetRoot = Utils.getRootName(update.getPath());

                    if (targetRoot == null) {
                        System.err.println(String.format("Skipped revision %d because of a null root",
                                revision.getNumber()));
                        continue;
                    }

                    final String targetLabel = computeNodeLabel(targetRoot, revision.getNumber());

                    if (Utils.isTagPath(update.getPath())) {
                        graphWriter.setNodeStyle(tagStyle);
                    } else {
                        if (!nodeStyles.containsKey(targetRoot)) {
                            final NodeStyle style = new NodeStyle();
                            style.setFillColor(randomColor());

                            nodeStyles.put(targetRoot, style);
                        }

                        graphWriter.setNodeStyle(nodeStyles.get(targetRoot));
                    }

                    final String targetId;

                    if (nodeIdsPerLabel.containsKey(targetLabel)) {
                        // retrieve the id of the existing node
                        targetId = nodeIdsPerLabel.get(targetLabel);
                    } else {
                        // create the new node
                        if (Utils.isTagPath(update.getPath())) {
                            graphWriter.setNodeStyle(tagStyle);
                        } else {
                            if (!nodeStyles.containsKey(targetRoot)) {
                                final NodeStyle style = new NodeStyle();
                                style.setFillColor(randomColor());

                                nodeStyles.put(targetRoot, style);
                            }

                            graphWriter.setNodeStyle(nodeStyles.get(targetRoot));
                        }

                        targetId = graphWriter.node(targetLabel);

                        nodeIdsPerLabel.put(targetLabel, targetId);
                    }

                    // create an edge between the 2 nodes
                    graphWriter.edge(sourceId, targetId);
                } else {
                    System.out.println(String.format("  > %s %s", update.getAction(), update.getPath()));
                }
            }

            System.out.println();

            count++;
        }

        // Dispatch the revisions per corresponding branch
        final Map<String, Set<Long>> revisionsPerBranch = new TreeMap<>();

        for (String nodeLabel : nodeIdsPerLabel.keySet()) {
            if (nodeLabel.contains("@")) {
                final String branchName = StringUtils.substringBefore(nodeLabel, "@");
                final long revision = Long.parseLong(StringUtils.substringAfter(nodeLabel, "@"));

                if (!revisionsPerBranch.containsKey(branchName)) {
                    revisionsPerBranch.put(branchName, new TreeSet<Long>());
                }

                revisionsPerBranch.get(branchName).add(revision);
            } else {
                throw new IllegalStateException(nodeLabel);
            }
        }

        // Recreate the missing edges between revisions from a same branch
        for (String branchName : revisionsPerBranch.keySet()) {
            final List<Long> branchRevisions = new ArrayList<>(revisionsPerBranch.get(branchName));

            for (int i = 0; i < branchRevisions.size() - 1; i++) {
                final String nodeLabel1 = String.format("%s@%d", branchName, branchRevisions.get(i));
                final String nodeLabel2 = String.format("%s@%d", branchName, branchRevisions.get(i + 1));

                graphWriter.edge(nodeIdsPerLabel.get(nodeLabel1), nodeIdsPerLabel.get(nodeLabel2));
            }
        }

        graphWriter.closeGraph();

        System.out.println(String.format("Found %d significant revisions", count));
    } finally {
        if (graphWriter != null) {
            graphWriter.close();
        }
        if (fileWriter != null) {
            fileWriter.close();
        }
    }

    System.out.println("Done");
}

From source file:edu.msu.cme.rdp.graph.utils.ContigMerger.java

public static void main(String[] args) throws IOException {
    final BufferedReader hmmgsResultReader;
    final IndexedSeqReader nuclContigReader;
    final double minBits;
    final int minProtLength;
    final Options options = new Options();
    final PrintStream out;
    final ProfileHMM hmm;
    final FastaWriter protSeqOut;
    final FastaWriter nuclSeqOut;
    final boolean prot;
    final boolean all;
    final String shortSampleName;

    options.addOption("a", "all", false,
            "Generate all combinations for multiple paths, instead of just the best");
    options.addOption("b", "min-bits", true, "Minimum bits score");
    options.addOption("l", "min-length", true, "Minimum length");
    options.addOption("s", "short_samplename", true,
            "short sample name, to be used as part of contig identifiers. This allow analyzing contigs together from different samples in downstream analysis ");
    options.addOption("o", "out", true, "Write output to file instead of stdout");

    try {/* w w  w  . ja v a  2  s  .c om*/
        CommandLine line = new PosixParser().parse(options, args);

        if (line.hasOption("min-bits")) {
            minBits = Double.valueOf(line.getOptionValue("min-bits"));
        } else {
            minBits = Double.NEGATIVE_INFINITY;
        }

        if (line.hasOption("min-length")) {
            minProtLength = Integer.valueOf(line.getOptionValue("min-length"));
        } else {
            minProtLength = 0;
        }

        if (line.hasOption("short_samplename")) {
            shortSampleName = line.getOptionValue("short_samplename") + "_";
        } else {
            shortSampleName = "";
        }

        if (line.hasOption("out")) {
            out = new PrintStream(line.getOptionValue("out"));
        } else {
            out = System.err;
        }

        all = line.hasOption("all");

        args = line.getArgs();

        if (args.length != 3) {
            throw new Exception("Unexpected number of arguments");
        }

        hmmgsResultReader = new BufferedReader(new FileReader(new File(args[1])));
        nuclContigReader = new IndexedSeqReader(new File(args[2]));
        hmm = HMMER3bParser.readModel(new File(args[0]));

        prot = (hmm.getAlphabet() == SequenceType.Protein);

        if (prot) {
            protSeqOut = new FastaWriter(new File("prot_merged.fasta"));
        } else {
            protSeqOut = null;
        }
        nuclSeqOut = new FastaWriter(new File("nucl_merged.fasta"));

    } catch (Exception e) {
        new HelpFormatter().printHelp("USAGE: ContigMerger [options] <hmm> <hmmgs_file> <nucl_contig>",
                options);
        System.err.println("Error: " + e.getMessage());
        System.exit(1);
        throw new RuntimeException("I hate you javac");
    }

    String line;
    SearchDirection lastDir = SearchDirection.left; //So this has an assumption built in
    //It depends on hmmgs always outputting left fragments, then right
    //We can't just use the kmer to figure out if we've switched to another starting point
    //because we allow multiple starting model pos, so two different starting
    //positions can have the same starting kmer

    Map<String, Sequence> leftContigs = new HashMap();
    Map<String, Sequence> rightContigs = new HashMap();

    int contigsMerged = 0;
    int writtenMerges = 0;
    long startTime = System.currentTimeMillis();
    String kmer = null;
    String geneName = null;

    while ((line = hmmgsResultReader.readLine()) != null) {
        if (line.startsWith("#")) {
            continue;
        }

        String[] lexemes = line.trim().split("\t");
        if (lexemes.length != 12 || lexemes[0].equals("-")) {
            System.err.println("Skipping line: " + line);
            continue;
        }
        //contig_53493   nirk   1500:6:35:16409:3561/1   ADV15048   tcggcgctctacacgttcctgcagcccggg   40   210   70   left   -44.692   184   0
        int index = 0;

        String seqid = lexemes[0];
        geneName = lexemes[1];
        String readid = lexemes[2];
        String refid = lexemes[3];
        kmer = lexemes[4];
        int modelStart = Integer.valueOf(lexemes[5]);

        int nuclLength = Integer.valueOf(lexemes[6]);
        int protLength = Integer.valueOf(lexemes[7]);

        SearchDirection dir = SearchDirection.valueOf(lexemes[8]);
        if (dir != lastDir) {
            if (dir == SearchDirection.left) {
                List<MergedContig> mergedContigs = all
                        ? mergeAllContigs(leftContigs, rightContigs, kmer, geneName, hmm)
                        : mergeContigs(leftContigs, rightContigs, kmer, geneName, hmm);

                contigsMerged++;

                for (MergedContig mc : mergedContigs) {
                    String mergedId = shortSampleName + geneName + "_" + mc.leftContig + "_" + mc.rightContig;
                    out.println(mergedId + "\t" + mc.length + "\t" + mc.score);

                    if (mc.score > minBits && mc.length > minProtLength) {
                        if (prot) {
                            protSeqOut.writeSeq(mergedId, mc.protSeq);
                        }
                        nuclSeqOut.writeSeq(mergedId, mc.nuclSeq);

                        writtenMerges++;
                    }
                }
                leftContigs.clear();
                rightContigs.clear();
            }

            lastDir = dir;
        }

        Sequence seq = nuclContigReader.readSeq(seqid);

        if (dir == SearchDirection.left) {
            leftContigs.put(seqid, seq);
        } else if (dir == SearchDirection.right) {
            rightContigs.put(seqid, seq);
        } else {
            throw new IOException("Cannot handle search direction " + dir);
        }
    }

    if (!leftContigs.isEmpty() || !rightContigs.isEmpty()) {
        List<MergedContig> mergedContigs = all ? mergeAllContigs(leftContigs, rightContigs, kmer, geneName, hmm)
                : mergeContigs(leftContigs, rightContigs, kmer, geneName, hmm);

        for (MergedContig mc : mergedContigs) {
            String mergedId = shortSampleName + mc.gene + "_" + mc.leftContig + "_" + mc.rightContig;
            out.println(mergedId + "\t" + mc.length + "\t" + mc.score);
            contigsMerged++;

            if (mc.score > minBits && mc.length > minProtLength) {
                if (prot) {
                    protSeqOut.writeSeq(mergedId, mc.protSeq);
                }
                nuclSeqOut.writeSeq(mergedId, mc.nuclSeq);
                writtenMerges++;
            }
        }
    }

    out.close();
    if (prot) {
        protSeqOut.close();
    }
    nuclSeqOut.close();

    System.err.println("Read in " + contigsMerged + " contigs, wrote out " + writtenMerges
            + " merged contigs in " + ((double) (System.currentTimeMillis() - startTime) / 1000) + "s");
}

From source file:com.acapulcoapp.alloggiatiweb.FileReader.java

public static void main(String[] args) throws UnknownHostException, IOException {
    // TODO code application logic here

    SpringApplication app = new SpringApplication(AcapulcoappApp.class);
    SimpleCommandLinePropertySource source = new SimpleCommandLinePropertySource(args);
    addDefaultProfile(app, source);/*from  ww  w.j  a  va 2s  . c o  m*/

    ConfigurableApplicationContext context = app.run(args);

    initBeans(context);

    Map<LocalDate, List<List<String>>> map = new TreeMap<>();

    List<File> files = new ArrayList<>(FileUtils.listFiles(new File("/Users/chiccomask/Downloads/ALLOGGIATI"),
            new String[] { "txt" }, true));

    Collections.reverse(files);

    int count = 0;

    for (File file : files) {

        //            List<String> allLines = FileUtils.readLines(file, "windows-1252");
        List<String> allLines = FileUtils.readLines(file, "UTF-8");

        for (int i = 0; i < allLines.size();) {

            count++;

            List<String> record = new ArrayList<>();

            String line = allLines.get(i);
            String type = TIPO_ALLOGGIO.parse(line);

            switch (type) {
            case "16":
                record.add(line);
                i++;
                break;
            case "17": {
                record.add(line);
                boolean out = false;
                while (!out) {
                    i++;
                    if (i < allLines.size()) {
                        String subline = allLines.get(i);
                        String subtype = TIPO_ALLOGGIO.parse(subline);
                        if (!subtype.equals("19")) {
                            out = true;
                        } else {
                            record.add(subline);
                        }
                    } else {
                        out = true;
                    }
                }
                break;
            }
            case "18": {
                record.add(line);
                boolean out = false;
                while (!out) {
                    i++;
                    if (i < allLines.size()) {
                        String subline = allLines.get(i);
                        String subtype = TIPO_ALLOGGIO.parse(subline);
                        if (!subtype.equals("20")) {
                            out = true;
                        } else {
                            record.add(subline);
                        }
                    } else {
                        out = true;
                    }
                }
                break;
            }
            default:
                break;
            }

            LocalDate arrived = LocalDate.parse(DATA_ARRIVO.parse(line),
                    DateTimeFormatter.ofPattern(DATE_PATTERN));
            if (!map.containsKey(arrived)) {
                map.put(arrived, new ArrayList<>());
            }
            map.get(arrived).add(record);
        }
    }

    for (LocalDate date : map.keySet()) {

        System.out.println();
        System.out.println("process day " + date);

        for (List<String> record : map.get(date)) {

            System.out.println();
            System.out.println("process record ");
            for (String line : record) {
                System.out.println(line);
            }

            CheckinRecord checkinRecord = new CheckinRecord();

            //non lo setto per adesso
            String firstLine = record.get(0);

            String typeStr = TIPO_ALLOGGIO.parse(firstLine);
            CheckinType cht = checkinTypeRepository.find(typeStr);
            checkinRecord.setCheckinType(cht);

            int days = Integer.parseInt(PERMANENZA.parse(firstLine));
            checkinRecord.setDays(days);
            checkinRecord.setArrived(date);

            boolean isMain = true;

            List<Person> others = new ArrayList<>();

            for (String line : record) {
                Person p = extractPerson(line);

                if (p.getDistrictOfBirth() == null) {
                    System.out.println("district of birth not found " + p);
                }

                List<Person> duplicates = personRepository.findDuplicates(p.getSurname(), p.getName(),
                        p.getDateOfBirth());

                if (duplicates.isEmpty()) {
                    System.out.println("add new person " + p.getId() + " " + p);
                    personRepository.saveAndFlush(p);
                } else if (duplicates.size() == 1) {

                    Person found = duplicates.get(0);

                    if (p.getIdentityDocument() != null) {
                        //we sorted by date so we suppose 
                        //the file version is newer so we update the entity
                        p.setId(found.getId());
                        System.out.println("update person " + p.getId() + " " + p);
                        personRepository.saveAndFlush(p);

                    } else if (found.getIdentityDocument() != null) {
                        //on db there are more data so I use them.
                        p = found;
                        System.out.println("use already saved person " + p.getId() + " " + p);
                    } else {
                        p.setId(found.getId());
                        System.out.println("update person " + p.getId() + " " + p);
                        personRepository.saveAndFlush(p);
                    }

                } else {
                    throw new RuntimeException("More duplicated for " + p.getName());
                }

                if (isMain) {
                    checkinRecord.setMainPerson(p);
                    isMain = false;
                } else {
                    others.add(p);
                }
            }

            checkinRecord.setOtherPeople(new HashSet<>(others));

            if (checkinRecordRepository.alreadyExists(checkinRecord.getMainPerson(), date) != null) {
                System.out.println("already exists " + date + " p " + checkinRecord.getMainPerson());
            } else {
                System.out.println("save record ");
                checkinRecordRepository.saveAndFlush(checkinRecord);
            }
        }
    }

    //
    //            if (type.equals("16")) {
    //                List<String> record = new ArrayList<>();
    //                record.add(line);
    //                keepOpen = false;
    //            }
    //
    //            map.get(arrived).add(record);
    //        map.values().forEach((list) -> {
    //
    //            for (String line : list) {
    //
    //                Person p = null;
    //
    //                try {
    //
    //                    p = extractPerson(line);
    //
    //                    List<Person> duplicates = personRepository.findDuplicates(p.getSurname(), p.getName(), p.getDateOfBirth());
    //
    //                    if (duplicates.isEmpty()) {
    //                        personRepository.saveAndFlush(p);
    //
    //                    } else if (duplicates.size() > 1) {
    //                        System.out.println();
    //                        System.out.println("MULIPLE DUPLICATED");
    //
    //                        for (Person dd : duplicates) {
    //                            System.out.println(dd);
    //                        }
    //                        System.out.println("* " + p);
    //                        throw new RuntimeException();
    //                    } else {
    //
    ////                        if (!duplicates.get(0).getDistrictOfBirth().equals(p.getDistrictOfBirth())) {
    ////                        int index = 0;
    ////
    ////                        System.out.println();
    ////                        System.out.println("DUPLICATED");
    ////
    ////                        for (Person dd : duplicates) {
    ////                            System.out.println(dd);
    ////                            index++;
    ////                        }
    ////                        System.out.println("* " + p);
    ////                        System.out.println(file.getAbsolutePath() + " " + p);
    ////
    ////                        System.out.println();
    ////                        System.out.println();
    ////                        }
    ////                        duplicates.remove(0);
    ////                        personRepository.deleteInBatch(duplicates);
    ////                System.out.println();
    ////                System.out.println("Seleziona scelta");
    ////                Scanner s = new Scanner(System.in);
    ////                int selected;
    ////                try {
    ////                    selected = s.nextInt();
    ////                } catch (InputMismatchException e) {
    ////                    selected = 0;
    ////                }
    ////
    ////                if (duplicates.size() <= selected) {
    ////                    personRepository.deleteInBatch(duplicates);
    ////                    personRepository.saveAndFlush(p);
    ////                } else {
    ////                    duplicates.remove(selected);
    ////                    personRepository.deleteInBatch(duplicates);
    ////                }
    //                    }
    //
    //                } catch (Exception e) {
    //
    //                    System.out.println();
    ////                    System.out.println("ERROR READING lineCount=" + allLines.indexOf(line) + " line=" + line);
    ////                    System.out.println(file.getAbsolutePath());
    //                    System.out.println(p);
    //                    e.printStackTrace();
    //                    System.out.println();
    //                }
    //            }
    //        });
    context.registerShutdownHook();

    System.exit(0);
}

From source file:com.foo.manager.commonManager.thread.HttpHandleThread.java

public static void main(String arg[]) {

    //      String logistics_interface = "<LoadHead><loadContents><loadContent><loadContentId>1</loadContentId><outorderId>6666666666</outorderId></loadContent><loadContent><loadContentId>2</loadContentId><outorderId>7777777777</outorderId></loadContent></loadContents><loadHeadId>12</loadHeadId><loadId>1736474588</loadId><total>2</total><tracyNum>3</tracyNum><TotalWeight>2.5</TotalWeight><CarEcNo>?A234234</CarEcNo></LoadHead>";
    ///*from w  w  w  . j a v  a2 s.com*/
    //      String data_digest = CommonUtil.makeSign(logistics_interface);
    //
    //      System.out.println(data_digest);
    //      try {
    //         System.out
    //               .println("logistics_interface="
    //                     + URLEncoder.encode(logistics_interface, "utf-8")
    //                     + "&data_digest="
    //                     + URLEncoder.encode(data_digest, "utf-8"));
    //      } catch (UnsupportedEncodingException e) {
    //         // TODO Auto-generated catch block
    //         e.printStackTrace();
    //      }
    //
    //      try {
    //         System.out.println(URLEncoder.encode("helloworld", "utf-8"));
    //         System.out.println(URLEncoder.encode("voQc3u6+f6pSflMPdw4ySQ==",
    //               "utf-8"));
    //      } catch (UnsupportedEncodingException e) {
    //         // TODO Auto-generated catch block
    //         e.printStackTrace();
    //      }
    List<Map<String, Object>> list = new ArrayList<Map<String, Object>>();
    Map<String, Object> map1 = new HashMap<String, Object>();
    map1.put("RECORD_NO", "335");
    map1.put("CREAT_TIME", "2018-09-14 21:46:17");
    Map<String, Object> map2 = new HashMap<String, Object>();
    map2.put("RECORD_NO", "145");
    map2.put("CREAT_TIME", "2018-09-14 23:46:17");
    Map<String, Object> map3 = new HashMap<String, Object>();
    map3.put("RECORD_NO", "285");
    map3.put("CREAT_TIME", "2018-09-14 22:46:17");
    Map<String, Object> map4 = new HashMap<String, Object>();
    map4.put("RECORD_NO", "265");
    map4.put("CREAT_TIME", "2018-09-14 22:46:17");
    list.add(map1);
    list.add(map2);
    list.add(map3);
    list.add(map4);
    // ??
    for (Map<String, Object> map : list) {
        System.out.println(map);
    }

    Collections.sort(list, new Comparator<Map>() {
        public int compare(Map o1, Map o2) {
            //            double qty1 = Double.valueOf(o1.get("QTY")
            //                  .toString());
            //            double qty2 = Double.valueOf(o2.get("QTY")
            //                  .toString());
            String recordNo1 = o1.get("RECORD_NO") != null ? o1.get("RECORD_NO").toString() : "";
            String recordNo2 = o2.get("RECORD_NO") != null ? o2.get("RECORD_NO").toString() : "";
            //            if (qty1 > qty2) {
            if (recordNo1.compareTo(recordNo2) < 0) {
                return 0;
            } else {
                return 1;
            }
            //            } else {
            //               return 0;
            //            }
        }
    });

    System.out.println("-------------------");
    for (Map<String, Object> map : list) {
        System.out.println(map);
    }
    //
    //      String s = "<![CDATA[?]]>";
    //      Pattern p = Pattern.compile(".*<!\\[CDATA\\[(.*)\\]\\]>.*");
    //      Matcher m = p.matcher(s);
    //
    //      if (m.matches()) {
    //         System.out.println(m.group(1));
    //      }else{
    //         System.out.println(s);
    //      }
    //      
    //      System.out.println(CommonUtil.getDateFormatter(CommonDefine.COMMON_FORMAT_2)
    //               .format(new Date()));

    //      String response = "<?xml version=\"1.0\" encoding=\"utf-8\"?><soapenv:Envelope xmlns:soapenv=\"http://www.w3.org/2003/05/soap-envelope\"><soapenv:Body><ns:sendOrderResponse xmlns:ns=\"http://ws.com\"><ns:return><?xml version=\"1.0\" encoding=\"UTF-8\"?><DATA><ORDER><ORDER_CODE>W100133410</ORDER_CODE><CD>OK</CD><INFO>11811000073</INFO></ORDER></DATA></ns:return></ns:sendOrderResponse></soapenv:Body></soapenv:Envelope>";
    //      
    //      String xxxx = StringEscapeUtils.escapeXml(response);

    //      String returnXmlData = XmlUtil
    //            .getResponseFromXmlString_CJ(xxxx);

    //      String returnXmlData = XmlUtil.getTotalMidValue(response,"<ns:return>","</ns:return>");
    //      
    //      Map orderResult = XmlUtil.parseXmlFPAPI_SingleNodes(returnXmlData, "//DATA/ORDER/child::*");

    //      System.out.println(xxxx);

    //      System.out.println(orderResult);

    try {
        String xxx = "<returnInfo>?????????????</returnInfo>";

        xxx = "<returnInfo>?????????????/returnInfo>";

        //         String xxx = "??[??3201966A69??AAAA124613101110701] ?[3201966A69]??[AAAA124613101110701]??? ??[1210680001]???[245119218897]???? ?[3201966A69]??[AAAA124613101110701]??";

        //         String uft_gbk = new String(xxx.getBytes("UTF-8"),"GBK");

        String gbk_utf = new String(xxx.getBytes("GBK"), "UTF-8");

        //         System.out.println(uft_gbk);
        System.out.println(gbk_utf);
    } catch (UnsupportedEncodingException e) {
        // TODO Auto-generated catch block
        e.printStackTrace();
    }

}

From source file:edu.upenn.cis.FastAlign.java

/**
 * Prints alignments for options specified by command line arguments.
 * @param argv  parameters to be used by FastAlign.
 *//* w  w w  .ja v  a  2s  . c o m*/
public static void main(String[] argv) {

    FastAlign align = FastAlign.initCommandLine(argv);
    if (align == null) {
        System.err.println("Usage: java " + FastAlign.class.getCanonicalName() + " -i file.fr-en\n"
                + " Standard options ([USE] = strongly recommended):\n" + "  -i: [REQ] Input parallel corpus\n"
                + "  -v: [USE] Use Dirichlet prior on lexical translation distributions\n"
                + "  -d: [USE] Favor alignment points close to the monotonic diagonoal\n"
                + "  -o: [USE] Optimize how close to the diagonal alignment points should be\n"
                + "  -r: Run alignment in reverse (condition on target and predict source)\n"
                + "  -c: Output conditional probability table\n"
                + "  -e: Start with existing conditional probability table\n" + " Advanced options:\n"
                + "  -I: number of iterations in EM training (default = 5)\n"
                + "  -p: p_null parameter (default = 0.08)\n" + "  -N: No null word\n"
                + "  -a: alpha parameter for optional Dirichlet prior (default = 0.01)\n"
                + "  -T: starting lambda for diagonal distance parameter (default = 4)\n");
        System.exit(1);
    }
    boolean use_null = !align.no_null_word;
    if (align.variational_bayes && align.alpha <= 0.0) {
        System.err.println("--alpha must be > 0\n");
        System.exit(1);
    }
    double prob_align_not_null = 1.0 - align.prob_align_null;
    final int kNULL = align.d.Convert("<eps>");
    TTable s2t = new TTable();
    if (!align.existing_probability_filename.isEmpty()) {
        boolean success = s2t.ImportFromFile(align.existing_probability_filename, '\t', align.d);
        if (!success) {
            System.err.println("Can't read table " + align.existing_probability_filename);
            System.exit(1);
        }
    }
    Map<Pair, Integer> size_counts = new HashMap<Pair, Integer>();
    double tot_len_ratio = 0;
    double mean_srclen_multiplier = 0;
    List<Double> probs = new ArrayList<Double>();
    ;
    // E-M Iterations Loop TODO move this into a method?
    for (int iter = 0; iter < align.iterations || (iter == 0 && align.iterations == 0); ++iter) {
        final boolean final_iteration = (iter >= (align.iterations - 1));
        System.err.println("ITERATION " + (iter + 1) + (final_iteration ? " (FINAL)" : ""));
        Scanner in = null;
        try {
            in = new Scanner(new File(align.input));
            if (!in.hasNextLine()) {
                System.err.println("Can't read " + align.input);
                System.exit(1);
            }
        } catch (FileNotFoundException e) {
            e.printStackTrace();
            System.err.println("Can't read " + align.input);
            System.exit(1);
        }

        double likelihood = 0;
        double denom = 0.0;
        int lc = 0;
        boolean flag = false;
        String line;
        //         String ssrc, strg;
        ArrayList<Integer> src = new ArrayList<Integer>();
        ArrayList<Integer> trg = new ArrayList<Integer>();
        double c0 = 0;
        double emp_feat = 0;
        double toks = 0;
        // Iterate over each line of the input file
        while (in.hasNextLine()) {
            line = in.nextLine();
            ++lc;
            if (lc % 1000 == 0) {
                System.err.print('.');
                flag = true;
            }
            if (lc % 50000 == 0) {
                System.err.println(" [" + lc + "]\n");
                System.err.flush();
                flag = false;
            }
            src.clear();
            trg.clear(); // TODO this is redundant; src and tgt cleared in ParseLine
            // Integerize and split source and target lines.
            align.ParseLine(line, src, trg);
            if (align.is_reverse) {
                ArrayList<Integer> tmp = src;
                src = trg;
                trg = tmp;
            }
            // TODO Empty lines break the parser. Should this be true?
            if (src.size() == 0 || trg.size() == 0) {
                System.err.println("Error in line " + lc + "\n" + line);
                System.exit(1);
            }
            if (iter == 0) {
                tot_len_ratio += ((double) trg.size()) / ((double) src.size());
            }
            denom += trg.size();
            probs.clear();
            // Add to pair length counts only if first iteration.
            if (iter == 0) {
                Pair pair = new Pair(trg.size(), src.size());
                Integer value = size_counts.get(pair);
                if (value == null)
                    value = 0;
                size_counts.put(pair, value + 1);
            }
            boolean first_al = true; // used when printing alignments
            toks += trg.size();
            // Iterate through the English tokens
            for (int j = 0; j < trg.size(); ++j) {
                final int f_j = trg.get(j);
                double sum = 0;
                double prob_a_i = 1.0 / (src.size() + (use_null ? 1 : 0)); // uniform (model 1)
                if (use_null) {
                    if (align.favor_diagonal) {
                        prob_a_i = align.prob_align_null;
                    }
                    probs.add(0, s2t.prob(kNULL, f_j) * prob_a_i);
                    sum += probs.get(0);
                }
                double az = 0;
                if (align.favor_diagonal)
                    az = DiagonalAlignment.computeZ(j + 1, trg.size(), src.size(), align.diagonal_tension)
                            / prob_align_not_null;
                for (int i = 1; i <= src.size(); ++i) {
                    if (align.favor_diagonal)
                        prob_a_i = DiagonalAlignment.unnormalizedProb(j + 1, i, trg.size(), src.size(),
                                align.diagonal_tension) / az;
                    probs.add(i, s2t.prob(src.get(i - 1), f_j) * prob_a_i);
                    sum += probs.get(i);
                }
                if (final_iteration) {
                    double max_p = -1;
                    int max_index = -1;
                    if (use_null) {
                        max_index = 0;
                        max_p = probs.get(0);
                    }
                    for (int i = 1; i <= src.size(); ++i) {
                        if (probs.get(i) > max_p) {
                            max_index = i;
                            max_p = probs.get(i);
                        }
                    }
                    if (max_index > 0) {
                        if (first_al)
                            first_al = false;
                        else
                            System.out.print(' ');
                        if (align.is_reverse)
                            System.out.print("" + j + '-' + (max_index - 1));
                        else
                            System.out.print("" + (max_index - 1) + '-' + j);
                    }
                } else {
                    if (use_null) {
                        double count = probs.get(0) / sum;
                        c0 += count;
                        s2t.Increment(kNULL, f_j, count);
                    }
                    for (int i = 1; i <= src.size(); ++i) {
                        final double p = probs.get(i) / sum;
                        s2t.Increment(src.get(i - 1), f_j, p);
                        emp_feat += DiagonalAlignment.feature(j, i, trg.size(), src.size()) * p;
                    }
                }
                likelihood += Math.log(sum);
            }
            if (final_iteration)
                System.out.println();
        }

        // log(e) = 1.0
        double base2_likelihood = likelihood / Math.log(2);

        if (flag) {
            System.err.println();
        }
        if (iter == 0) {
            mean_srclen_multiplier = tot_len_ratio / lc;
            System.err.println("expected target length = source length * " + mean_srclen_multiplier);
        }
        emp_feat /= toks;
        System.err.println("  log_e likelihood: " + likelihood);
        System.err.println("  log_2 likelihood: " + base2_likelihood);
        System.err.println("     cross entropy: " + (-base2_likelihood / denom));
        System.err.println("        perplexity: " + Math.pow(2.0, -base2_likelihood / denom));
        System.err.println("      posterior p0: " + c0 / toks);
        System.err.println(" posterior al-feat: " + emp_feat);
        //System.err.println("     model tension: " + mod_feat / toks );
        System.err.println("       size counts: " + size_counts.size());
        if (!final_iteration) {
            if (align.favor_diagonal && align.optimize_tension && iter > 0) {
                for (int ii = 0; ii < 8; ++ii) {
                    double mod_feat = 0;
                    Iterator<Map.Entry<Pair, Integer>> it = size_counts.entrySet().iterator();
                    for (; it.hasNext();) {
                        Map.Entry<Pair, Integer> entry = it.next();
                        final Pair p = entry.getKey();
                        for (int j = 1; j <= p.first; ++j)
                            mod_feat += entry.getValue() * DiagonalAlignment.computeDLogZ(j, p.first, p.second,
                                    align.diagonal_tension);
                    }
                    mod_feat /= toks;
                    System.err.println("  " + ii + 1 + "  model al-feat: " + mod_feat + " (tension="
                            + align.diagonal_tension + ")");
                    align.diagonal_tension += (emp_feat - mod_feat) * 20.0;
                    if (align.diagonal_tension <= 0.1)
                        align.diagonal_tension = 0.1;
                    if (align.diagonal_tension > 14)
                        align.diagonal_tension = 14;
                }
                System.err.println("     final tension: " + align.diagonal_tension);
            }
            if (align.variational_bayes)
                s2t.NormalizeVB(align.alpha);
            else
                s2t.Normalize();
            //prob_align_null *= 0.8; // XXX
            //prob_align_null += (c0 / toks) * 0.2;
            prob_align_not_null = 1.0 - align.prob_align_null;
        }

    }
    if (!align.conditional_probability_filename.isEmpty()) {
        System.err.println("conditional probabilities: " + align.conditional_probability_filename);
        s2t.ExportToFile(align.conditional_probability_filename, align.d);
    }
    System.exit(0);
}