Example usage for java.lang Double valueOf

List of usage examples for java.lang Double valueOf

  1. HOME
  2. Java
  3. java
  4. java.lang.*
  5. Double
  6. valueOf

Introduction

In this page you can find the example usage for java.lang Double valueOf.

Prototype

@HotSpotIntrinsicCandidate
public static Double valueOf(double d)

Source Link

Document

Returns a Double instance representing the specified double value.

Usage

From source file:de.tudarmstadt.ukp.experiments.argumentation.convincingness.sampling.Step5GoldLabelEstimator.java

@SuppressWarnings("unchecked")
public static void main(String[] args) throws Exception {
    String inputDir = args[0];//from  www  .j  a va2 s  .c  om
    File outputDir = new File(args[1]);

    if (!outputDir.exists()) {
        outputDir.mkdirs();
    }

    // we will process only a subset first
    List<AnnotatedArgumentPair> allArgumentPairs = new ArrayList<>();

    Collection<File> files = IOHelper.listXmlFiles(new File(inputDir));

    for (File file : files) {
        allArgumentPairs.addAll((List<AnnotatedArgumentPair>) XStreamTools.getXStream().fromXML(file));
    }

    // collect turkers and csv
    List<String> turkerIDs = extractAndSortTurkerIDs(allArgumentPairs);
    String preparedCSV = prepareCSV(allArgumentPairs, turkerIDs);

    // save CSV and run MACE
    Path tmpDir = Files.createTempDirectory("mace");
    File maceInputFile = new File(tmpDir.toFile(), "input.csv");
    FileUtils.writeStringToFile(maceInputFile, preparedCSV, "utf-8");

    File outputPredictions = new File(tmpDir.toFile(), "predictions.txt");
    File outputCompetence = new File(tmpDir.toFile(), "competence.txt");

    // run MACE
    MACE.main(new String[] { "--iterations", "500", "--threshold", String.valueOf(MACE_THRESHOLD), "--restarts",
            "50", "--outputPredictions", outputPredictions.getAbsolutePath(), "--outputCompetence",
            outputCompetence.getAbsolutePath(), maceInputFile.getAbsolutePath() });

    // read back the predictions and competence
    List<String> predictions = FileUtils.readLines(outputPredictions, "utf-8");

    // check the output
    if (predictions.size() != allArgumentPairs.size()) {
        throw new IllegalStateException("Wrong size of the predicted file; expected " + allArgumentPairs.size()
                + " lines but was " + predictions.size());
    }

    String competenceRaw = FileUtils.readFileToString(outputCompetence, "utf-8");
    String[] competence = competenceRaw.split("\t");
    if (competence.length != turkerIDs.size()) {
        throw new IllegalStateException(
                "Expected " + turkerIDs.size() + " competence number, got " + competence.length);
    }

    // rank turkers by competence
    Map<String, Double> turkerIDCompetenceMap = new TreeMap<>();
    for (int i = 0; i < turkerIDs.size(); i++) {
        turkerIDCompetenceMap.put(turkerIDs.get(i), Double.valueOf(competence[i]));
    }

    // sort by value descending
    Map<String, Double> sortedCompetences = IOHelper.sortByValue(turkerIDCompetenceMap, false);
    System.out.println("Sorted turker competences: " + sortedCompetences);

    // assign the gold label and competence

    for (int i = 0; i < allArgumentPairs.size(); i++) {
        AnnotatedArgumentPair annotatedArgumentPair = allArgumentPairs.get(i);
        String goldLabel = predictions.get(i).trim();

        // might be empty
        if (!goldLabel.isEmpty()) {
            // so far the gold label has format aXXX_aYYY_a1, aXXX_aYYY_a2, or aXXX_aYYY_equal
            // strip now only the gold label
            annotatedArgumentPair.setGoldLabel(goldLabel);
        }

        // update turker competence
        for (AnnotatedArgumentPair.MTurkAssignment assignment : annotatedArgumentPair.mTurkAssignments) {
            String turkID = assignment.getTurkID();

            int turkRank = getTurkerRank(turkID, sortedCompetences);
            assignment.setTurkRank(turkRank);

            double turkCompetence = turkerIDCompetenceMap.get(turkID);
            assignment.setTurkCompetence(turkCompetence);
        }
    }

    // now sort the data back according to their original file name
    Map<String, List<AnnotatedArgumentPair>> fileNameAnnotatedPairsMap = new HashMap<>();
    for (AnnotatedArgumentPair argumentPair : allArgumentPairs) {
        String fileName = IOHelper.createFileName(argumentPair.getDebateMetaData(),
                argumentPair.getArg1().getStance());

        if (!fileNameAnnotatedPairsMap.containsKey(fileName)) {
            fileNameAnnotatedPairsMap.put(fileName, new ArrayList<AnnotatedArgumentPair>());
        }

        fileNameAnnotatedPairsMap.get(fileName).add(argumentPair);
    }

    // and save them to the output file
    for (Map.Entry<String, List<AnnotatedArgumentPair>> entry : fileNameAnnotatedPairsMap.entrySet()) {
        String fileName = entry.getKey();
        List<AnnotatedArgumentPair> argumentPairs = entry.getValue();

        File outputFile = new File(outputDir, fileName);

        // and save all sampled pairs into a XML file
        XStreamTools.toXML(argumentPairs, outputFile);

        System.out.println("Saved " + argumentPairs.size() + " pairs to " + outputFile);
    }

}

From source file:com.github.houbin217jz.thumbnail.Thumbnail.java

public static void main(String[] args) {

    Options options = new Options();
    options.addOption("s", "src", true,
            "????????????");
    options.addOption("d", "dst", true, "");
    options.addOption("r", "ratio", true, "/??, 30%???0.3????????");
    options.addOption("w", "width", true, "(px)");
    options.addOption("h", "height", true, "?(px)");
    options.addOption("R", "recursive", false, "???????");

    HelpFormatter formatter = new HelpFormatter();
    String formatstr = "java -jar thumbnail.jar " + "[-s/--src <path>] " + "[-d/--dst <path>] "
            + "[-r/--ratio double] " + "[-w/--width integer] " + "[-h/--height integer] " + "[-R/--recursive] ";

    CommandLineParser parser = new PosixParser();
    CommandLine cmd = null;//w  ww. ja va 2 s.  co m
    try {
        cmd = parser.parse(options, args);
    } catch (ParseException e1) {
        formatter.printHelp(formatstr, options);
        return;
    }

    final Path srcDir, dstDir;
    final Integer width, height;
    final Double ratio;

    //
    if (cmd.hasOption("s")) {
        srcDir = Paths.get(cmd.getOptionValue("s")).toAbsolutePath();
    } else {
        srcDir = Paths.get("").toAbsolutePath(); //??
    }

    //
    if (cmd.hasOption("d")) {
        dstDir = Paths.get(cmd.getOptionValue("d")).toAbsolutePath();
    } else {
        formatter.printHelp(formatstr, options);
        return;
    }

    if (!Files.exists(srcDir, LinkOption.NOFOLLOW_LINKS)
            || !Files.isDirectory(srcDir, LinkOption.NOFOLLOW_LINKS)) {
        System.out.println("[" + srcDir.toAbsolutePath() + "]??????");
        return;
    }

    if (Files.exists(dstDir, LinkOption.NOFOLLOW_LINKS)) {
        if (!Files.isDirectory(dstDir, LinkOption.NOFOLLOW_LINKS)) {
            //????????
            System.out.println("????????");
            return;
        }
    } else {
        //????????
        try {
            Files.createDirectories(dstDir);
        } catch (IOException e) {
            e.printStackTrace();
            return;
        }
    }

    //??
    if (cmd.hasOption("w") && cmd.hasOption("h")) {
        try {
            width = Integer.valueOf(cmd.getOptionValue("width"));
            height = Integer.valueOf(cmd.getOptionValue("height"));
        } catch (NumberFormatException e) {
            System.out.println("??????");
            return;
        }
    } else {
        width = null;
        height = null;
    }

    //?
    if (cmd.hasOption("r")) {
        try {
            ratio = Double.valueOf(cmd.getOptionValue("r"));
        } catch (NumberFormatException e) {
            System.out.println("?????");
            return;
        }
    } else {
        ratio = null;
    }

    if (width != null && ratio != null) {
        System.out.println("??????????????");
        return;
    }

    if (width == null && ratio == null) {
        System.out.println("????????????");
        return;
    }

    //
    int maxDepth = 1;
    if (cmd.hasOption("R")) {
        maxDepth = Integer.MAX_VALUE;
    }

    try {
        //Java 7 ??@see http://docs.oracle.com/javase/jp/7/api/java/nio/file/Files.html
        Files.walkFileTree(srcDir, EnumSet.of(FileVisitOption.FOLLOW_LINKS), maxDepth,
                new SimpleFileVisitor<Path>() {
                    @Override
                    public FileVisitResult visitFile(Path path, BasicFileAttributes basicFileAttributes)
                            throws IOException {

                        //???&???
                        String filename = path.getFileName().toString().toLowerCase();

                        if (filename.endsWith(".jpg") || filename.endsWith(".jpeg")) {
                            //Jpeg??

                            /*
                             * relative??:
                             * rootPath: /a/b/c/d
                             * filePath: /a/b/c/d/e/f.jpg
                             * rootPath.relativize(filePath) = e/f.jpg
                             */

                            /*
                             * resolve??
                             * rootPath: /a/b/c/output
                             * relativePath: e/f.jpg
                             * rootPath.resolve(relativePath) = /a/b/c/output/e/f.jpg
                             */

                            Path dst = dstDir.resolve(srcDir.relativize(path));

                            if (!Files.exists(dst.getParent(), LinkOption.NOFOLLOW_LINKS)) {
                                Files.createDirectories(dst.getParent());
                            }
                            doResize(path.toFile(), dst.toFile(), width, height, ratio);
                        }
                        return FileVisitResult.CONTINUE;
                    }
                });
    } catch (IOException e) {
        e.printStackTrace();
    }
}

From source file:ch.algotrader.starter.SimulationStarter.java

public static void main(String[] args) throws ConvergenceException, FunctionEvaluationException {

    if (args[0].equals("simulateWithCurrentParams")) {

        runSimulation((simulationExecutor, strategyGroup) -> simulationExecutor
                .simulateWithCurrentParams(strategyGroup));

    } else if (args[0].equals("simulateBySingleParam")) {

        for (int i = 1; i < args.length; i++) {
            String[] params = args[i].split(":");
            runSimulation((simulationExecutor, strategyGroup) -> simulationExecutor
                    .simulateBySingleParam(strategyGroup, params[0], params[1]));

        }/*from   w  ww .  j  a  v a  2s  . co m*/

    } else if (args[0].equals("simulateByMultiParam")) {

        for (int i = 1; i < args.length; i++) {
            String[] touples = args[i].split(",");
            String[] parameters = new String[touples.length];
            String[] values = new String[touples.length];
            for (int j = 0; j < touples.length; j++) {
                parameters[j] = touples[j].split(":")[0];
                values[j] = touples[j].split(":")[1];
            }
            runSimulation((simulationExecutor, strategyGroup) -> simulationExecutor
                    .simulateByMultiParam(strategyGroup, parameters, values));

        }

    } else if (args[0].equals("optimizeSingleParamLinear")) {

        for (int i = 1; i < args.length; i++) {
            String[] params = args[i].split(":");
            String parameter = params[0];
            double min = Double.parseDouble(params[1]);
            double max = Double.parseDouble(params[2]);
            double increment = Double.parseDouble(params[3]);

            runSimulation((simulationExecutor, strategyGroup) -> simulationExecutor
                    .optimizeSingleParamLinear(strategyGroup, parameter, min, max, increment));

        }

    } else if (args[0].equals("optimizeSingleParamByValues")) {

        for (int i = 1; i < args.length; i++) {
            String[] params = args[i].split(":");
            String parameter = params[0];
            double[] values = new double[params.length - 1];
            for (int j = 1; j < params.length; j++) {
                values[j - 1] = Double.valueOf(params[j]);
            }

            runSimulation((simulationExecutor, strategyGroup) -> simulationExecutor
                    .optimizeSingleParamByValues(strategyGroup, parameter, values));

        }
    } else if (args[0].equals("optimizeSingleParam")) {

        String[] params = args[1].split(":");
        String parameter = params[0];
        double min = Double.valueOf(params[1]);
        double max = Double.valueOf(params[2]);
        double accuracy = Double.valueOf(params[3]);

        runSimulation((simulationExecutor, strategyGroup) -> simulationExecutor
                .optimizeSingleParam(strategyGroup, parameter, min, max, accuracy));

    } else if (args[0].equals("optimizeMultiParamLinear")) {

        String[] parameters = new String[args.length - 1];
        double[] mins = new double[args.length - 1];
        double[] maxs = new double[args.length - 1];
        double[] increments = new double[args.length - 1];
        for (int i = 1; i < args.length; i++) {

            String[] params = args[i].split(":");
            String parameter = params[0];
            double min = Double.valueOf(params[1]);
            double max = Double.valueOf(params[2]);
            double increment = Double.valueOf(params[3]);

            parameters[i - 1] = parameter;
            mins[i - 1] = min;
            maxs[i - 1] = max;
            increments[i - 1] = increment;
        }

        runSimulation((simulationExecutor, strategyGroup) -> simulationExecutor
                .optimizeMultiParamLinear(strategyGroup, parameters, mins, maxs, increments));

    } else if (args[0].equals("optimizeMultiParam")) {

        String[] parameters = new String[args.length - 1];
        double[] starts = new double[args.length - 1];
        for (int i = 1; i < args.length; i++) {

            String[] params = args[i].split(":");
            String parameter = params[0];
            double start = Double.valueOf(params[1]);
            parameters[i - 1] = parameter;
            starts[i - 1] = start;
        }

        runSimulation((simulationExecutor, strategyGroup) -> simulationExecutor
                .optimizeMultiParam(strategyGroup, parameters, starts));

    } else {
        if (LOGGER.isInfoEnabled()) {
            LOGGER.info("invalid command {}", args[0]);
        }
    }
}

From source file:com.github.brandtg.StlPlotter.java

public static void main(String[] args) throws Exception {
    List<Long> times = new ArrayList<>();
    List<Number> series = new ArrayList<>();
    try (InputStream is = new FileInputStream(args[1]);
            BufferedReader reader = new BufferedReader(new InputStreamReader(is))) {
        String line = reader.readLine(); // header
        while ((line = reader.readLine()) != null) {
            String[] tokens = line.split(",");
            times.add(Long.valueOf(tokens[0]));
            series.add(Double.valueOf(tokens[1]));
        }/*from w ww.  j  a v a2  s  . c o m*/
    }

    StlConfig config = new StlConfig();
    config.setNumberOfObservations(Integer.valueOf(args[0]));
    config.setNumberOfDataPoints(times.size());
    config.setNumberOfRobustnessIterations(1);
    config.setPeriodic(true);

    StlResult result = new StlDecomposition(config).decompose(times, series);

    plot(result);
}

From source file:edu.msu.cme.rdp.abundstats.cli.AbundMain.java

public static void main(String[] args) throws IOException {
    File inputFile;//www  . j  a v  a 2 s .  c o m
    File resultDir = new File(".");
    RPlotter plotter = null;
    boolean isClusterFile = true;
    List<AbundStatsCalculator> statCalcs = new ArrayList();
    double clustCutoffFrom = Double.MIN_VALUE, clustCutoffTo = Double.MAX_VALUE;

    String usage = "Main [options] <cluster file>";
    try {
        CommandLine line = new PosixParser().parse(options, args);

        if (line.hasOption("result-dir")) {
            resultDir = new File(line.getOptionValue("result-dir"));
            if (!resultDir.exists() && !resultDir.mkdirs()) {
                throw new Exception(
                        "Result directory " + resultDir + " does not exist and could not be created");
            }
        }

        if (line.hasOption("R-location")) {
            plotter = new RPlotter();
            plotter.setCommandTemplate(rplotterTemplate);
            plotter.setRPath(line.getOptionValue("R-location"));
            plotter.setOutFileExt(".png");

            if (!new File(plotter.getRPath()).canExecute()) {
                throw new Exception(plotter.getRPath() + " does not exist or is not exectuable");
            }
        }

        if (line.hasOption("lower-cutoff")) {
            clustCutoffFrom = Double.valueOf(line.getOptionValue("lower-cutoff"));
        }

        if (line.hasOption("upper-cutoff")) {
            clustCutoffTo = Double.valueOf(line.getOptionValue("upper-cutoff"));
        }

        if (line.hasOption("jaccard")) {
            statCalcs.add(new Jaccard(true));
        }

        if (line.hasOption("sorensen")) {
            statCalcs.add(new Sorensen(true));
        }

        if (line.hasOption("otu-table")) {
            isClusterFile = false;
        }

        if (statCalcs.isEmpty()) {
            throw new Exception("Must specify at least one stat to compute (jaccard, sorensen)");
        }

        args = line.getArgs();
        if (args.length != 1) {
            throw new Exception("Unexpected number of command line arguments");
        }

        inputFile = new File(args[0]);

    } catch (Exception e) {
        new HelpFormatter().printHelp(usage, options);
        System.err.println("Error: " + e.getMessage());
        return;
    }

    if (isClusterFile) {
        RDPClustParser parser;
        parser = new RDPClustParser(inputFile);

        try {
            if (parser.getClusterSamples().size() == 1) {
                throw new IOException("Cluster file must have more than one sample");
            }

            List<Cutoff> cutoffs = parser.getCutoffs(clustCutoffFrom, clustCutoffTo);
            if (cutoffs.isEmpty()) {
                throw new IOException(
                        "No cutoffs in cluster file in range [" + clustCutoffFrom + "-" + clustCutoffTo + "]");
            }

            for (Cutoff cutoff : cutoffs) {
                List<Sample> samples = new ArrayList();

                for (ClusterSample clustSample : parser.getClusterSamples()) {
                    Sample s = new Sample(clustSample.getName());
                    for (Cluster clust : cutoff.getClusters().get(clustSample.getName())) {
                        s.addSpecies(clust.getNumberOfSeqs());
                    }
                    samples.add(s);
                }

                processSamples(samples, statCalcs, resultDir, cutoff.getCutoff() + "_", plotter);
            }

        } finally {
            parser.close();
        }
    } else {
        List<Sample> samples = new ArrayList();
        BufferedReader reader = new BufferedReader(new FileReader(inputFile));
        String line = reader.readLine();

        if (line == null || line.split("\\s+").length < 2) {
            throw new IOException("Must be 2 or more samples for abundance statistic calculations!");
        }
        int numSamples = line.split("\\s+").length;

        boolean header = true;
        try {
            Integer.valueOf(line.split("\\s+")[0]);
            header = false;
        } catch (Exception e) {
        }

        if (header) {
            for (String s : line.split("\\s+")) {
                samples.add(new Sample(s));
            }
        } else {
            int sample = 0;
            for (String s : line.split("\\s+")) {
                samples.add(new Sample("" + sample));
                samples.get(sample).addSpecies(Integer.valueOf(s));
                sample++;
            }
        }

        int lineno = 2;
        while ((line = reader.readLine()) != null) {
            if (line.trim().equals("")) {
                continue;
            }
            int sample = 0;
            if (line.split("\\s+").length != numSamples) {
                System.err.println(
                        "Line number " + lineno + " didn't have the expected number of samples (contained "
                                + line.split("\\s+").length + ", expected " + numSamples + ")");
            }

            for (String s : line.split("\\s+")) {
                samples.get(sample).addSpecies(Integer.valueOf(s));
                sample++;
            }

            lineno++;
        }

        processSamples(samples, statCalcs, resultDir, inputFile.getName(), plotter);
    }
}

From source file:com.github.brandtg.stl.StlPlotter.java

public static void main(String[] args) throws Exception {
    List<Double> times = new ArrayList<Double>();
    List<Double> series = new ArrayList<Double>();
    List<Double> trend = new ArrayList<Double>();
    List<Double> seasonal = new ArrayList<Double>();
    List<Double> remainder = new ArrayList<Double>();

    // Read from STDIN
    String line;//from   w  w w  .  j  a va 2s  .  c o m
    BufferedReader reader = new BufferedReader(new InputStreamReader(System.in));
    while ((line = reader.readLine()) != null) {
        String[] tokens = line.split(",");
        times.add(Double.valueOf(tokens[0]));
        series.add(Double.valueOf(tokens[1]));
        trend.add(Double.valueOf(tokens[2]));
        seasonal.add(Double.valueOf(tokens[3]));
        remainder.add(Double.valueOf(tokens[4]));
    }

    StlResult res = new StlResult(convert(times), convert(series), convert(trend), convert(seasonal),
            convert(remainder));

    if (args.length == 1) {
        plot(res, new File(args[0]));
    } else {
        plotOnScreen(res, "Seasonal Decomposition");
    }
}

From source file:com.github.ruananswer.stl.StlPlotter.java

public static void main(String[] args) throws Exception {
    List<Double> times = new ArrayList<Double>();
    List<Double> series = new ArrayList<Double>();
    List<Double> trend = new ArrayList<Double>();
    List<Double> seasonal = new ArrayList<Double>();
    List<Double> remainder = new ArrayList<Double>();

    // Read from STDIN
    String line;//from w w w  . j  a va2s  . c  om
    BufferedReader reader = new BufferedReader(new InputStreamReader(System.in));
    while ((line = reader.readLine()) != null) {
        String[] tokens = line.split(",");
        times.add(Double.valueOf(tokens[0]));
        series.add(Double.valueOf(tokens[1]));
        trend.add(Double.valueOf(tokens[2]));
        seasonal.add(Double.valueOf(tokens[3]));
        remainder.add(Double.valueOf(tokens[4]));
    }

    STLResult res = new STLResult(convert(trend), convert(seasonal), convert(remainder));

    double[] tmpSeries = convert(series);
    double[] tmpTimes = convert(times);

    if (args.length == 1) {
        plot(res, tmpSeries, tmpTimes, new File(args[0]));
    } else {
        plotOnScreen(res, tmpSeries, tmpTimes, "Seasonal Decomposition");
    }
}

From source file:edu.msu.cme.rdp.graph.utils.ContigMerger.java

public static void main(String[] args) throws IOException {
    final BufferedReader hmmgsResultReader;
    final IndexedSeqReader nuclContigReader;
    final double minBits;
    final int minProtLength;
    final Options options = new Options();
    final PrintStream out;
    final ProfileHMM hmm;
    final FastaWriter protSeqOut;
    final FastaWriter nuclSeqOut;
    final boolean prot;
    final boolean all;
    final String shortSampleName;

    options.addOption("a", "all", false,
            "Generate all combinations for multiple paths, instead of just the best");
    options.addOption("b", "min-bits", true, "Minimum bits score");
    options.addOption("l", "min-length", true, "Minimum length");
    options.addOption("s", "short_samplename", true,
            "short sample name, to be used as part of contig identifiers. This allow analyzing contigs together from different samples in downstream analysis ");
    options.addOption("o", "out", true, "Write output to file instead of stdout");

    try {//from  www .  j  a  va2 s .  co m
        CommandLine line = new PosixParser().parse(options, args);

        if (line.hasOption("min-bits")) {
            minBits = Double.valueOf(line.getOptionValue("min-bits"));
        } else {
            minBits = Double.NEGATIVE_INFINITY;
        }

        if (line.hasOption("min-length")) {
            minProtLength = Integer.valueOf(line.getOptionValue("min-length"));
        } else {
            minProtLength = 0;
        }

        if (line.hasOption("short_samplename")) {
            shortSampleName = line.getOptionValue("short_samplename") + "_";
        } else {
            shortSampleName = "";
        }

        if (line.hasOption("out")) {
            out = new PrintStream(line.getOptionValue("out"));
        } else {
            out = System.err;
        }

        all = line.hasOption("all");

        args = line.getArgs();

        if (args.length != 3) {
            throw new Exception("Unexpected number of arguments");
        }

        hmmgsResultReader = new BufferedReader(new FileReader(new File(args[1])));
        nuclContigReader = new IndexedSeqReader(new File(args[2]));
        hmm = HMMER3bParser.readModel(new File(args[0]));

        prot = (hmm.getAlphabet() == SequenceType.Protein);

        if (prot) {
            protSeqOut = new FastaWriter(new File("prot_merged.fasta"));
        } else {
            protSeqOut = null;
        }
        nuclSeqOut = new FastaWriter(new File("nucl_merged.fasta"));

    } catch (Exception e) {
        new HelpFormatter().printHelp("USAGE: ContigMerger [options] <hmm> <hmmgs_file> <nucl_contig>",
                options);
        System.err.println("Error: " + e.getMessage());
        System.exit(1);
        throw new RuntimeException("I hate you javac");
    }

    String line;
    SearchDirection lastDir = SearchDirection.left; //So this has an assumption built in
    //It depends on hmmgs always outputting left fragments, then right
    //We can't just use the kmer to figure out if we've switched to another starting point
    //because we allow multiple starting model pos, so two different starting
    //positions can have the same starting kmer

    Map<String, Sequence> leftContigs = new HashMap();
    Map<String, Sequence> rightContigs = new HashMap();

    int contigsMerged = 0;
    int writtenMerges = 0;
    long startTime = System.currentTimeMillis();
    String kmer = null;
    String geneName = null;

    while ((line = hmmgsResultReader.readLine()) != null) {
        if (line.startsWith("#")) {
            continue;
        }

        String[] lexemes = line.trim().split("\t");
        if (lexemes.length != 12 || lexemes[0].equals("-")) {
            System.err.println("Skipping line: " + line);
            continue;
        }
        //contig_53493   nirk   1500:6:35:16409:3561/1   ADV15048   tcggcgctctacacgttcctgcagcccggg   40   210   70   left   -44.692   184   0
        int index = 0;

        String seqid = lexemes[0];
        geneName = lexemes[1];
        String readid = lexemes[2];
        String refid = lexemes[3];
        kmer = lexemes[4];
        int modelStart = Integer.valueOf(lexemes[5]);

        int nuclLength = Integer.valueOf(lexemes[6]);
        int protLength = Integer.valueOf(lexemes[7]);

        SearchDirection dir = SearchDirection.valueOf(lexemes[8]);
        if (dir != lastDir) {
            if (dir == SearchDirection.left) {
                List<MergedContig> mergedContigs = all
                        ? mergeAllContigs(leftContigs, rightContigs, kmer, geneName, hmm)
                        : mergeContigs(leftContigs, rightContigs, kmer, geneName, hmm);

                contigsMerged++;

                for (MergedContig mc : mergedContigs) {
                    String mergedId = shortSampleName + geneName + "_" + mc.leftContig + "_" + mc.rightContig;
                    out.println(mergedId + "\t" + mc.length + "\t" + mc.score);

                    if (mc.score > minBits && mc.length > minProtLength) {
                        if (prot) {
                            protSeqOut.writeSeq(mergedId, mc.protSeq);
                        }
                        nuclSeqOut.writeSeq(mergedId, mc.nuclSeq);

                        writtenMerges++;
                    }
                }
                leftContigs.clear();
                rightContigs.clear();
            }

            lastDir = dir;
        }

        Sequence seq = nuclContigReader.readSeq(seqid);

        if (dir == SearchDirection.left) {
            leftContigs.put(seqid, seq);
        } else if (dir == SearchDirection.right) {
            rightContigs.put(seqid, seq);
        } else {
            throw new IOException("Cannot handle search direction " + dir);
        }
    }

    if (!leftContigs.isEmpty() || !rightContigs.isEmpty()) {
        List<MergedContig> mergedContigs = all ? mergeAllContigs(leftContigs, rightContigs, kmer, geneName, hmm)
                : mergeContigs(leftContigs, rightContigs, kmer, geneName, hmm);

        for (MergedContig mc : mergedContigs) {
            String mergedId = shortSampleName + mc.gene + "_" + mc.leftContig + "_" + mc.rightContig;
            out.println(mergedId + "\t" + mc.length + "\t" + mc.score);
            contigsMerged++;

            if (mc.score > minBits && mc.length > minProtLength) {
                if (prot) {
                    protSeqOut.writeSeq(mergedId, mc.protSeq);
                }
                nuclSeqOut.writeSeq(mergedId, mc.nuclSeq);
                writtenMerges++;
            }
        }
    }

    out.close();
    if (prot) {
        protSeqOut.close();
    }
    nuclSeqOut.close();

    System.err.println("Read in " + contigsMerged + " contigs, wrote out " + writtenMerges
            + " merged contigs in " + ((double) (System.currentTimeMillis() - startTime) / 1000) + "s");
}

From source file:de.citec.csra.elancsv.parser.SimpleParser.java

public static void main(String[] args) throws IOException, ParseException {

    Options opts = new Options();
    opts.addOption("file", true, "Tab-separated ELAN export file to load.");
    opts.addOption("tier", true,
            "Tier to analyze. Optional: Append ::num to interpret annotations numerically.");
    opts.addOption("format", true,
            "How to read information from the file name. %V -> participant, %A -> annoatator, %C -> condition, e.g. \"%V - %A\"");
    opts.addOption("help", false, "Print this help and exit");

    CommandLineParser parser = new BasicParser();
    CommandLine cmd = parser.parse(opts, args);
    if (cmd.hasOption("help")) {
        helpExit(opts, "where OPTION includes:");
    }//from  w ww . jav a  2  s  . co m

    String infile = cmd.getOptionValue("file");
    if (infile == null) {
        helpExit(opts, "Error: no file given.");
    }

    String format = cmd.getOptionValue("format");
    if (format == null) {
        helpExit(opts, "Error: no format given.");
    }

    String tier = cmd.getOptionValue("tier");
    if (tier == null) {
        helpExit(opts, "Error: no tier given.");
    }

    //      TODO count values in annotations (e.g. search all robot occurrences)
    String[] tn = tier.split("::");
    boolean numeric = false;
    if (tn.length == 2 && tn[1].equals("num")) {
        numeric = true;
        tier = tn[0];
    }

    format = "^" + format + "$";
    format = format.replaceFirst("%V", "(?<V>.*?)");
    format = format.replaceFirst("%A", "(?<A>.*?)");
    format = format.replaceFirst("%C", "(?<C>.*?)");
    Pattern pa = Pattern.compile(format);

    Map<String, Participant> participants = new HashMap<>();
    BufferedReader br = new BufferedReader(new FileReader(infile));
    String line;
    int lineno = 0;
    while ((line = br.readLine()) != null) {
        String[] parts = line.split("\t");
        lineno++;
        if (parts.length < 5) {
            System.err.println("WARNING: line '" + lineno + "' too short '" + line + "'");
            continue;
        }
        Annotation a = new Annotation(Long.valueOf(parts[ElanFormat.START.field]),
                Long.valueOf(parts[ElanFormat.STOP.field]), Long.valueOf(parts[ElanFormat.DURATION.field]),
                parts[ElanFormat.VALUE.field]);
        String tname = parts[ElanFormat.TIER.field];
        String file = parts[ElanFormat.FILE.field].replaceAll(".eaf", "");

        Matcher m = pa.matcher(file);
        String vp = file;
        String condition = "?";
        String annotator = "?";
        String participantID = vp;

        if (m.find()) {
            vp = m.group("V");
            if (format.indexOf("<A>") > 0) {
                annotator = m.group("A");
            }

            if (format.indexOf("<C>") > 0) {
                condition = m.group("C");
            }
        }
        participantID = vp + ";" + annotator;

        if (!participants.containsKey(participantID)) {
            participants.put(participantID, new Participant(vp, condition, annotator));
        }
        Participant p = participants.get(participantID);

        if (!p.tiers.containsKey(tname)) {
            p.tiers.put(tname, new Tier(tname));
        }

        p.tiers.get(tname).annotations.add(a);

    }

    Map<String, Map<String, Number>> values = new HashMap<>();
    Set<String> rownames = new HashSet<>();

    String allCountKey = "c: all values";
    String allDurationKey = "d: all values";
    String allMeanKey = "m: all values";

    for (Map.Entry<String, Participant> e : participants.entrySet()) {
        //         System.out.println(e);
        Tier t = e.getValue().tiers.get(tier);
        String participantID = e.getKey();

        if (!values.containsKey(participantID)) {
            values.put(participantID, new HashMap<String, Number>());
        }
        Map<String, Number> row = values.get(participantID); //participant id

        if (t != null) {

            row.put(allCountKey, 0l);
            row.put(allDurationKey, 0l);
            row.put(allMeanKey, 0l);

            for (Annotation a : t.annotations) {

                long countAll = (long) row.get(allCountKey) + 1;
                long durationAll = (long) row.get(allDurationKey) + a.duration;
                long meanAll = durationAll / countAll;

                row.put(allCountKey, countAll);
                row.put(allDurationKey, durationAll);
                row.put(allMeanKey, meanAll);

                if (!numeric) {
                    String countKey = "c: " + a.value;
                    String durationKey = "d: " + a.value;
                    String meanKey = "m: " + a.value;

                    if (!row.containsKey(countKey)) {
                        row.put(countKey, 0l);
                    }
                    if (!row.containsKey(durationKey)) {
                        row.put(durationKey, 0l);
                    }
                    if (!row.containsKey(meanKey)) {
                        row.put(meanKey, 0d);
                    }

                    long count = (long) row.get(countKey) + 1;
                    long duration = (long) row.get(durationKey) + a.duration;
                    double mean = duration * 1.0 / count;

                    row.put(countKey, count);
                    row.put(durationKey, duration);
                    row.put(meanKey, mean);

                    rownames.add(countKey);
                    rownames.add(durationKey);
                    rownames.add(meanKey);
                } else {
                    String countKey = "c: " + t.name;
                    String sumKey = "s: " + t.name;
                    String meanKey = "m: " + t.name;

                    if (!row.containsKey(countKey)) {
                        row.put(countKey, 0l);
                    }
                    if (!row.containsKey(sumKey)) {
                        row.put(sumKey, 0d);
                    }
                    if (!row.containsKey(meanKey)) {
                        row.put(meanKey, 0d);
                    }

                    double d = 0;
                    try {
                        d = Double.valueOf(a.value);
                    } catch (NumberFormatException ex) {

                    }

                    long count = (long) row.get(countKey) + 1;
                    double sum = (double) row.get(sumKey) + d;
                    double mean = sum / count;

                    row.put(countKey, count);
                    row.put(sumKey, sum);
                    row.put(meanKey, mean);

                    rownames.add(countKey);
                    rownames.add(sumKey);
                    rownames.add(meanKey);
                }

            }
        }

    }

    ArrayList<String> list = new ArrayList(rownames);
    Collections.sort(list);
    StringBuilder header = new StringBuilder("ID;Annotator;");
    header.append(allCountKey);
    header.append(";");
    header.append(allDurationKey);
    header.append(";");
    header.append(allMeanKey);
    header.append(";");
    for (String l : list) {
        header.append(l);
        header.append(";");
    }
    System.out.println(header);

    for (Map.Entry<String, Map<String, Number>> e : values.entrySet()) {
        StringBuilder row = new StringBuilder(e.getKey());
        row.append(";");
        if (e.getValue().containsKey(allCountKey)) {
            row.append(e.getValue().get(allCountKey));
        } else {
            row.append("0");
        }
        row.append(";");
        if (e.getValue().containsKey(allDurationKey)) {
            row.append(e.getValue().get(allDurationKey));
        } else {
            row.append("0");
        }
        row.append(";");
        if (e.getValue().containsKey(allMeanKey)) {
            row.append(e.getValue().get(allMeanKey));
        } else {
            row.append("0");
        }
        row.append(";");
        for (String l : list) {
            if (e.getValue().containsKey(l)) {
                row.append(e.getValue().get(l));
            } else {
                row.append("0");
            }
            row.append(";");
        }
        System.out.println(row);
    }
}

From source file:com.test.demo.ccbpay.XLSX2CSV.java

public static void main(String[] args) throws Exception {
    File f = new File(
            "C:\\Users\\dmall\\Desktop\\???\\1493142812All2018-05-15_2018-05-20.csv");
    InputStreamReader reader = new InputStreamReader(new FileInputStream(f), "GBK");
    CSVReader csvReader = new CSVReader(reader);
    String[] csvRow = null; // row
    long csvDataSize = 0;
    long pay0515 = 0L;
    long re0515 = 0L;
    long cost0515 = 0L;
    while ((csvRow = csvReader.readNext()) != null) {
        if (csvRow.length != 24) {
            continue;
        }/*from  ww  w  .j a  v a 2  s  .  c o  m*/

        csvDataSize += 1;
        if (csvDataSize > 1) {
            if (csvRow[0].contains("2018-05-17")) {
                pay0515 += BigDecimal.valueOf(Double.valueOf(csvRow[12].substring(1, csvRow[12].length())))
                        .multiply(new BigDecimal(100)).longValue();
                re0515 += BigDecimal.valueOf(Double.valueOf(csvRow[16].substring(1, csvRow[16].length())))
                        .multiply(new BigDecimal(100)).longValue();
                cost0515 += BigDecimal.valueOf(Double.valueOf(csvRow[22].substring(1, csvRow[22].length())))
                        .multiply(new BigDecimal(100)).longValue();
            }
        }

    }

    System.out.println(pay0515);
    System.out.println(re0515);
    System.out.println(cost0515);
    System.out.println(pay0515 - re0515 - cost0515);
}