List of usage examples for java.io BufferedReader readLine
public String readLine() throws IOException
From source file:com.yahoo.labs.yamall.local.Yamall.java
public static void main(String[] args) { String[] remainingArgs = null; String inputFile = null;/*from w ww. j ava 2 s . co m*/ String predsFile = null; String saveModelFile = null; String initialModelFile = null; String lossName = null; String parserName = null; String linkName = null; String invertHashName = null; double learningRate = 1; String minPredictionString = null; String maxPredictionString = null; String fmNumberFactorsString = null; int bitsHash; int numberPasses; int holdoutPeriod = 10; boolean testOnly = false; boolean exponentialProgress; double progressInterval; options.addOption("h", "help", false, "displays this help"); options.addOption("t", false, "ignore label information and just test"); options.addOption(Option.builder().hasArg(false).required(false).longOpt("binary") .desc("reports loss as binary classification with -1,1 labels").build()); options.addOption( Option.builder().hasArg(false).required(false).longOpt("solo").desc("uses SOLO optimizer").build()); options.addOption(Option.builder().hasArg(false).required(false).longOpt("pcsolo") .desc("uses Per Coordinate SOLO optimizer").build()); options.addOption(Option.builder().hasArg(false).required(false).longOpt("pistol") .desc("uses PiSTOL optimizer").build()); options.addOption(Option.builder().hasArg(false).required(false).longOpt("kt") .desc("(EXPERIMENTAL) uses KT optimizer").build()); options.addOption(Option.builder().hasArg(false).required(false).longOpt("pckt") .desc("(EXPERIMENTAL) uses Per Coordinate KT optimizer").build()); options.addOption(Option.builder().hasArg(false).required(false).longOpt("pccocob") .desc("(EXPERIMENTAL) uses Per Coordinate COCOB optimizer").build()); options.addOption(Option.builder().hasArg(false).required(false).longOpt("cocob") .desc("(EXPERIMENTAL) uses COCOB optimizer").build()); options.addOption( Option.builder().hasArg(false).required(false).longOpt("fm").desc("Factorization Machine").build()); options.addOption(Option.builder("f").hasArg(true).required(false).desc("final regressor to save") .type(String.class).longOpt("final_regressor").build()); options.addOption(Option.builder("p").hasArg(true).required(false).desc("file to output predictions to") .longOpt("predictions").type(String.class).build()); options.addOption( Option.builder("i").hasArg(true).required(false).desc("initial regressor(s) to load into memory") .longOpt("initial_regressor").type(String.class).build()); options.addOption(Option.builder().hasArg(true).required(false).desc( "specify the loss function to be used. Currently available ones are: absolute, squared (default), hinge, logistic") .longOpt("loss_function").type(String.class).build()); options.addOption(Option.builder().hasArg(true).required(false).desc( "specify the link function used in the output of the predictions. Currently available ones are: identity (default), logistic") .longOpt("link").type(String.class).build()); options.addOption(Option.builder().hasArg(true).required(false) .desc("output human-readable final regressor with feature names").longOpt("invert_hash") .type(String.class).build()); options.addOption( Option.builder("l").hasArg(true).required(false).desc("set (initial) learning Rate, default = 1.0") .longOpt("learning_rate").type(String.class).build()); options.addOption(Option.builder("b").hasArg(true).required(false) .desc("number of bits in the feature table, default = 18").longOpt("bit_precision") .type(String.class).build()); options.addOption(Option.builder("P").hasArg(true).required(false) .desc("progress update frequency, integer: additive; float: multiplicative, default = 2.0") .longOpt("progress").type(String.class).build()); options.addOption(Option.builder().hasArg(true).required(false) .desc("smallest prediction to output, before the link function, default = -50") .longOpt("min_prediction").type(String.class).build()); options.addOption(Option.builder().hasArg(true).required(false) .desc("smallest prediction to output, before the link function, default = 50") .longOpt("max_prediction").type(String.class).build()); options.addOption(Option.builder().hasArg(true).required(false) .desc("ignore namespaces beginning with the characters in <arg>").longOpt("ignore") .type(String.class).build()); options.addOption(Option.builder().hasArg(true).required(false).desc("number of training passes") .longOpt("passes").type(String.class).build()); options.addOption( Option.builder().hasArg(true).required(false).desc("holdout period for test only, default = 10") .longOpt("holdout_period").type(String.class).build()); options.addOption(Option.builder().hasArg(true).required(false) .desc("number of factors for Factorization Machines default = 8").longOpt("fmNumberFactors") .type(String.class).build()); options.addOption(Option.builder().hasArg(true).required(false) .desc("specify the parser to use. Currently available ones are: vw (default), libsvm, tsv") .longOpt("parser").type(String.class).build()); options.addOption(Option.builder().hasArg(true).required(false).desc("schema file for the TSV input") .longOpt("schema").type(String.class).build()); CommandLineParser parser = new DefaultParser(); CommandLine cmd = null; try { cmd = parser.parse(options, args); } catch (ParseException e) { System.out.println("Unrecognized option"); help(); } if (cmd.hasOption("h")) help(); if (cmd.hasOption("t")) testOnly = true; if (cmd.hasOption("binary")) { binary = true; System.out.println("Reporting binary loss"); } initialModelFile = cmd.getOptionValue("i"); predsFile = cmd.getOptionValue("p"); lossName = cmd.getOptionValue("loss_function", "squared"); linkName = cmd.getOptionValue("link", "identity"); saveModelFile = cmd.getOptionValue("f"); learningRate = Double.parseDouble(cmd.getOptionValue("l", "1.0")); bitsHash = Integer.parseInt(cmd.getOptionValue("b", "18")); invertHashName = cmd.getOptionValue("invert_hash"); minPredictionString = cmd.getOptionValue("min_prediction", "-50"); maxPredictionString = cmd.getOptionValue("max_prediction", "50"); fmNumberFactorsString = cmd.getOptionValue("fmNumberFactors", "8"); parserName = cmd.getOptionValue("parser", "vw"); numberPasses = Integer.parseInt(cmd.getOptionValue("passes", "1")); System.out.println("Number of passes = " + numberPasses); if (numberPasses > 1) { holdoutPeriod = Integer.parseInt(cmd.getOptionValue("holdout_period", "10")); System.out.println("Holdout period = " + holdoutPeriod); } remainingArgs = cmd.getArgs(); if (remainingArgs.length == 1) inputFile = remainingArgs[0]; InstanceParser instanceParser = null; if (parserName.equals("vw")) instanceParser = new VWParser(bitsHash, cmd.getOptionValue("ignore"), (invertHashName != null)); else if (parserName.equals("libsvm")) instanceParser = new LIBSVMParser(bitsHash, (invertHashName != null)); else if (parserName.equals("tsv")) { String schema = cmd.getOptionValue("schema"); if (schema == null) { System.out.println("TSV parser requires a schema file."); System.exit(0); } else { String spec = null; try { spec = new String(Files.readAllBytes(Paths.get(schema))); } catch (IOException e) { System.out.println("Error reading the TSV schema file."); e.printStackTrace(); System.exit(0); } instanceParser = new TSVParser(bitsHash, cmd.getOptionValue("ignore"), (invertHashName != null), spec); } } else { System.out.println("Unknown parser."); System.exit(0); } System.out.println("Num weight bits = " + bitsHash); // setup progress String progress = cmd.getOptionValue("P", "2.0"); if (progress.indexOf('.') >= 0) { exponentialProgress = true; progressInterval = (double) Double.parseDouble(progress); } else { exponentialProgress = false; progressInterval = (double) Integer.parseInt(progress); } // min and max predictions minPrediction = (double) Double.parseDouble(minPredictionString); maxPrediction = (double) Double.parseDouble(maxPredictionString); // number of factors for Factorization Machines fmNumberFactors = (int) Integer.parseInt(fmNumberFactorsString); // configure the learner Loss lossFnc = null; LinkFunction link = null; if (initialModelFile == null) { if (cmd.hasOption("kt")) { learner = new KT(bitsHash); } else if (cmd.hasOption("pckt")) { learner = new PerCoordinateKT(bitsHash); } else if (cmd.hasOption("pcsolo")) { learner = new PerCoordinateSOLO(bitsHash); } else if (cmd.hasOption("solo")) { learner = new SOLO(bitsHash); } else if (cmd.hasOption("pccocob")) { learner = new PerCoordinateCOCOB(bitsHash); } else if (cmd.hasOption("cocob")) { learner = new COCOB(bitsHash); } else if (cmd.hasOption("pistol")) { learner = new PerCoordinatePiSTOL(bitsHash); } else if (cmd.hasOption("fm")) { learner = new SGD_FM(bitsHash, fmNumberFactors); } else learner = new SGD_VW(bitsHash); } else { learner = IOLearner.loadLearner(initialModelFile); } // setup link function if (linkName.equals("identity")) { link = new IdentityLinkFunction(); } else if (linkName.equals("logistic")) { link = new LogisticLinkFunction(); } else { System.out.println("Unknown link function."); System.exit(0); } // setup loss function if (lossName.equals("squared")) { lossFnc = new SquareLoss(); } else if (lossName.equals("hinge")) { lossFnc = new HingeLoss(); } else if (lossName.equals("logistic")) { lossFnc = new LogisticLoss(); } else if (lossName.equals("absolute")) { lossFnc = new AbsLoss(); } else { System.out.println("Unknown loss function."); System.exit(0); } learner.setLoss(lossFnc); learner.setLearningRate(learningRate); // maximum range predictions System.out.println("Max prediction = " + maxPrediction + ", Min Prediction = " + minPrediction); // print information about the learner System.out.println(learner.toString()); // print information about the link function System.out.println(link.toString()); // print information about the parser System.out.println(instanceParser.toString()); // print information about ignored namespaces System.out.println("Ignored namespaces = " + cmd.getOptionValue("ignore", "")); long start = System.nanoTime(); FileInputStream fstream; try { BufferedReader br = null; if (inputFile != null) { fstream = new FileInputStream(inputFile); System.out.println("Reading datafile = " + inputFile); br = new BufferedReader(new InputStreamReader(fstream)); } else { System.out.println("Reading from console"); br = new BufferedReader(new InputStreamReader(System.in)); } File fout = null; FileOutputStream fos = null; BufferedWriter bw = null; if (predsFile != null) { fout = new File(predsFile); fos = new FileOutputStream(fout); bw = new BufferedWriter(new OutputStreamWriter(fos)); } try { System.out.println("average example current current current"); System.out.println("loss counter label predict features"); int iter = 0; double cumLoss = 0; double weightedSampleSum = 0; double sPlus = 0; double sMinus = 0; Instance sample = null; boolean justPrinted = false; int pass = 0; ObjectOutputStream ooutTr = null; ObjectOutputStream ooutHO = null; ObjectInputStream oinTr = null; double pred = 0; int limit = 1; double hError = Double.MAX_VALUE; double lastHError = Double.MAX_VALUE; int numTestSample = 0; int numTrainingSample = 0; int idx = 0; if (numberPasses > 1) { ooutTr = new ObjectOutputStream(new FileOutputStream("cache_training.bin")); ooutHO = new ObjectOutputStream(new FileOutputStream("cache_holdout.bin")); oinTr = new ObjectInputStream(new FileInputStream("cache_training.bin")); } do { while (true) { double score; if (pass > 0 && numberPasses > 1) { Instance tmp = (Instance) oinTr.readObject(); if (tmp != null) sample = tmp; else break; } else { String strLine = br.readLine(); if (strLine != null) sample = instanceParser.parse(strLine); else break; } justPrinted = false; idx++; if (numberPasses > 1 && pass == 0 && idx % holdoutPeriod == 0) { // store the current sample for the holdout set ooutHO.writeObject(sample); ooutHO.reset(); numTestSample++; } else { if (numberPasses > 1 && pass == 0) { ooutTr.writeObject(sample); ooutTr.reset(); numTrainingSample++; } iter++; if (testOnly) { // predict the sample score = learner.predict(sample); } else { // predict the sample and update the classifier using the sample score = learner.update(sample); } score = Math.min(Math.max(score, minPrediction), maxPrediction); pred = link.apply(score); if (!binary) cumLoss += learner.getLoss().lossValue(score, sample.getLabel()) * sample.getWeight(); else if (Math.signum(score) != sample.getLabel()) cumLoss += sample.getWeight(); weightedSampleSum += sample.getWeight(); if (sample.getLabel() > 0) sPlus = sPlus + sample.getWeight(); else sMinus = sMinus + sample.getWeight(); // output predictions to file if (predsFile != null) { bw.write(String.format("%.6f %s", pred, sample.getTag())); bw.newLine(); } // print statistics to screen if (iter == limit) { justPrinted = true; System.out.printf("%.6f %12d % .4f % .4f %d\n", cumLoss / weightedSampleSum, iter, sample.getLabel(), pred, sample.getVector().size()); if (exponentialProgress) limit *= progressInterval; else limit += progressInterval; } } } if (numberPasses > 1) { if (pass == 0) { // finished first pass of many // write a null at the end of the files ooutTr.writeObject(null); ooutHO.writeObject(null); ooutTr.flush(); ooutHO.flush(); ooutTr.close(); ooutHO.close(); System.out.println("finished first epoch"); System.out.println(numTrainingSample + " training samples"); System.out.println(numTestSample + " holdout samples saved"); } lastHError = hError; hError = evalHoldoutError(); } if (numberPasses > 1) { System.out.printf("Weighted loss on holdout on epoch %d = %.6f\n", pass + 1, hError); oinTr.close(); oinTr = new ObjectInputStream(new FileInputStream("cache_training.bin")); if (hError > lastHError) { System.out.println("Early stopping"); break; } } pass++; } while (pass < numberPasses); if (justPrinted == false) { System.out.printf("%.6f %12d % .4f % .4f %d\n", cumLoss / weightedSampleSum, iter, sample.getLabel(), pred, sample.getVector().size()); } System.out.println("finished run"); System.out.println(String.format("average loss best constant predictor: %.6f", lossFnc.lossConstantBinaryLabels(sPlus, sMinus))); if (saveModelFile != null) IOLearner.saveLearner(learner, saveModelFile); if (invertHashName != null) IOLearner.saveInvertHash(learner.getWeights(), instanceParser.getInvertHashMap(), invertHashName); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } catch (ClassNotFoundException e) { // TODO Auto-generated catch block e.printStackTrace(); } // close the input stream try { br.close(); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } // close the output stream if (predsFile != null) { try { bw.close(); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } } long millis = System.nanoTime() - start; System.out.printf("Elapsed time: %d min, %d sec\n", TimeUnit.NANOSECONDS.toMinutes(millis), TimeUnit.NANOSECONDS.toSeconds(millis) - 60 * TimeUnit.NANOSECONDS.toMinutes(millis)); } catch ( FileNotFoundException e) { System.out.println("Error opening the input file"); e.printStackTrace(); } }
From source file:ms1quant.MS1Quant.java
/** * @param args the command line arguments MS1Quant parameterfile *//*w w w. ja v a2 s . co m*/ public static void main(String[] args) throws Exception { BufferedReader reader = null; try { System.out.println( "================================================================================================="); System.out.println("Umpire MS1 quantification and feature detection analysis (version: " + UmpireInfo.GetInstance().Version + ")"); if (args.length < 3 || !args[1].startsWith("-mode")) { System.out .println("command : java -jar -Xmx10G MS1Quant.jar ms1quant.params -mode[1 or 2] [Option]"); System.out.println("\n-mode"); System.out.println("\t1:Single file mode--> mzXML_file PepXML_file"); System.out.println("\t\tEx: -mode1 file1.mzXML file1.pep.xml"); System.out.println( "\t2:Folder mode--> mzXML_Folder PepXML_Folder, all generated csv tables will be merged into a single csv file"); System.out.println("\t\tEx: -mode2 /data/mzxml/ /data/pepxml/"); System.out.println("\nOptions"); System.out.println( "\t-C\tNo of concurrent files to be processed (only for folder mode), Ex. -C5, default:1"); System.out.println("\t-p\tMinimum probability, Ex. -p0.9, default:0.9"); System.out.println("\t-ID\tDetect identified feature only"); System.out.println("\t-O\toutput folder, Ex. -O/data/"); return; } ConsoleLogger consoleLogger = new ConsoleLogger(); consoleLogger.SetConsoleLogger(Level.DEBUG); consoleLogger.SetFileLogger(Level.DEBUG, FilenameUtils.getFullPath(args[0]) + "ms1quant_debug.log"); Logger logger = Logger.getRootLogger(); logger.debug("Command: " + Arrays.toString(args)); logger.info("MS1Quant version: " + UmpireInfo.GetInstance().Version); String parameterfile = args[0]; logger.info("Parameter file: " + parameterfile); File paramfile = new File(parameterfile); if (!paramfile.exists()) { logger.error("Parameter file " + paramfile.getAbsolutePath() + " cannot be found. The program will exit."); } reader = new BufferedReader(new FileReader(paramfile.getAbsolutePath())); String line = ""; InstrumentParameter param = new InstrumentParameter(InstrumentParameter.InstrumentType.TOF5600); int NoCPUs = 2; int NoFile = 1; param.DetermineBGByID = false; param.EstimateBG = true; //<editor-fold defaultstate="collapsed" desc="Read parameter file"> while ((line = reader.readLine()) != null) { if (!"".equals(line) && !line.startsWith("#")) { logger.info(line); //System.out.println(line); if (line.split("=").length < 2) { continue; } if (line.split("=").length < 2) { continue; } String type = line.split("=")[0].trim(); if (type.startsWith("para.")) { type = type.replace("para.", "SE."); } String value = line.split("=")[1].trim(); switch (type) { case "Thread": { NoCPUs = Integer.parseInt(value); break; } //<editor-fold defaultstate="collapsed" desc="instrument parameters"> case "SE.MS1PPM": { param.MS1PPM = Float.parseFloat(value); break; } case "SE.MS2PPM": { param.MS2PPM = Float.parseFloat(value); break; } case "SE.SN": { param.SNThreshold = Float.parseFloat(value); break; } case "SE.MS2SN": { param.MS2SNThreshold = Float.parseFloat(value); break; } case "SE.MinMSIntensity": { param.MinMSIntensity = Float.parseFloat(value); break; } case "SE.MinMSMSIntensity": { param.MinMSMSIntensity = Float.parseFloat(value); break; } case "SE.MinRTRange": { param.MinRTRange = Float.parseFloat(value); break; } case "SE.MaxNoPeakCluster": { param.MaxNoPeakCluster = Integer.parseInt(value); param.MaxMS2NoPeakCluster = Integer.parseInt(value); break; } case "SE.MinNoPeakCluster": { param.MinNoPeakCluster = Integer.parseInt(value); param.MinMS2NoPeakCluster = Integer.parseInt(value); break; } case "SE.MinMS2NoPeakCluster": { param.MinMS2NoPeakCluster = Integer.parseInt(value); break; } case "SE.MaxCurveRTRange": { param.MaxCurveRTRange = Float.parseFloat(value); break; } case "SE.Resolution": { param.Resolution = Integer.parseInt(value); break; } case "SE.RTtol": { param.RTtol = Float.parseFloat(value); break; } case "SE.NoPeakPerMin": { param.NoPeakPerMin = Integer.parseInt(value); break; } case "SE.StartCharge": { param.StartCharge = Integer.parseInt(value); break; } case "SE.EndCharge": { param.EndCharge = Integer.parseInt(value); break; } case "SE.MS2StartCharge": { param.MS2StartCharge = Integer.parseInt(value); break; } case "SE.MS2EndCharge": { param.MS2EndCharge = Integer.parseInt(value); break; } case "SE.NoMissedScan": { param.NoMissedScan = Integer.parseInt(value); break; } case "SE.Denoise": { param.Denoise = Boolean.valueOf(value); break; } case "SE.EstimateBG": { param.EstimateBG = Boolean.valueOf(value); break; } case "SE.RemoveGroupedPeaks": { param.RemoveGroupedPeaks = Boolean.valueOf(value); break; } case "SE.MinFrag": { param.MinFrag = Integer.parseInt(value); break; } case "SE.IsoPattern": { param.IsoPattern = Float.valueOf(value); break; } case "SE.StartRT": { param.startRT = Float.valueOf(value); } case "SE.EndRT": { param.endRT = Float.valueOf(value); } //</editor-fold> } } } //</editor-fold> int mode = 1; if (args[1].equals("-mode2")) { mode = 2; } else if (args[1].equals("-mode1")) { mode = 1; } else { logger.error("-mode number not recongized. The program will exit."); } String mzXML = ""; String pepXML = ""; String mzXMLPath = ""; String pepXMLPath = ""; File mzXMLfile = null; File pepXMLfile = null; File mzXMLfolder = null; File pepXMLfolder = null; int idx = 0; if (mode == 1) { mzXML = args[2]; logger.info("Mode1 mzXML file: " + mzXML); mzXMLfile = new File(mzXML); if (!mzXMLfile.exists()) { logger.error("Mode1 mzXML file " + mzXMLfile.getAbsolutePath() + " cannot be found. The program will exit."); return; } pepXML = args[3]; logger.info("Mode1 pepXML file: " + pepXML); pepXMLfile = new File(pepXML); if (!pepXMLfile.exists()) { logger.error("Mode1 pepXML file " + pepXMLfile.getAbsolutePath() + " cannot be found. The program will exit."); return; } idx = 4; } else if (mode == 2) { mzXMLPath = args[2]; logger.info("Mode2 mzXML folder: " + mzXMLPath); mzXMLfolder = new File(mzXMLPath); if (!mzXMLfolder.exists()) { logger.error("Mode2 mzXML folder " + mzXMLfolder.getAbsolutePath() + " does not exist. The program will exit."); return; } pepXMLPath = args[3]; logger.info("Mode2 pepXML folder: " + pepXMLPath); pepXMLfolder = new File(pepXMLPath); if (!pepXMLfolder.exists()) { logger.error("Mode2 pepXML folder " + pepXMLfolder.getAbsolutePath() + " does not exist. The program will exit."); return; } idx = 4; } String outputfolder = ""; float MinProb = 0f; for (int i = idx; i < args.length; i++) { if (args[i].startsWith("-")) { if (args[i].equals("-ID")) { param.TargetIDOnly = true; logger.info("Detect ID feature only: true"); } if (args[i].startsWith("-O")) { outputfolder = args[i].substring(2); logger.info("Output folder: " + outputfolder); File outputfile = new File(outputfolder); if (!outputfolder.endsWith("\\") | outputfolder.endsWith("/")) { outputfolder += "/"; } if (!outputfile.exists()) { outputfile.mkdir(); } } if (args[i].startsWith("-C")) { try { NoFile = Integer.parseInt(args[i].substring(2)); logger.info("No of concurrent files: " + NoFile); } catch (Exception ex) { logger.error(args[i] + " is not a correct integer format, will process only one file at a time."); } } if (args[i].startsWith("-p")) { try { MinProb = Float.parseFloat(args[i].substring(2)); logger.info("probability threshold: " + MinProb); } catch (Exception ex) { logger.error(args[i] + " is not a correct format, will use 0 as threshold instead."); } } } } reader.close(); TandemParam tandemparam = new TandemParam(DBSearchParam.SearchInstrumentType.TOF5600); PTMManager.GetInstance(); if (param.TargetIDOnly) { param.EstimateBG = false; param.ApexDelta = 1.5f; param.NoMissedScan = 10; param.MiniOverlapP = 0.2f; param.RemoveGroupedPeaks = false; param.CheckMonoIsotopicApex = false; param.DetectByCWT = false; param.FillGapByBK = false; param.IsoCorrThreshold = -1f; param.SmoothFactor = 3; } if (mode == 1) { logger.info("Processing " + mzXMLfile.getAbsolutePath() + "...."); long time = System.currentTimeMillis(); LCMSPeakMS1 LCMS1 = new LCMSPeakMS1(mzXMLfile.getAbsolutePath(), NoCPUs); LCMS1.SetParameter(param); LCMS1.Resume = false; if (!param.TargetIDOnly) { LCMS1.CreatePeakFolder(); } LCMS1.ExportPeakClusterTable = true; if (pepXMLfile.exists()) { tandemparam.InteractPepXMLPath = pepXMLfile.getAbsolutePath(); LCMS1.ParsePepXML(tandemparam, MinProb); logger.info("No. of PSMs included: " + LCMS1.IDsummary.PSMList.size()); logger.info("No. of Peptide ions included: " + LCMS1.IDsummary.GetPepIonList().size()); } if (param.TargetIDOnly) { LCMS1.SaveSerializationFile = false; } if (param.TargetIDOnly || !LCMS1.ReadPeakCluster()) { LCMS1.PeakClusterDetection(); } if (pepXMLfile.exists()) { LCMS1.AssignQuant(false); LCMS1.IDsummary.ExportPepID(outputfolder); } time = System.currentTimeMillis() - time; logger.info(LCMS1.ParentmzXMLName + " processed time:" + String.format("%d hour, %d min, %d sec", TimeUnit.MILLISECONDS.toHours(time), TimeUnit.MILLISECONDS.toMinutes(time) - TimeUnit.HOURS.toMinutes(TimeUnit.MILLISECONDS.toHours(time)), TimeUnit.MILLISECONDS.toSeconds(time) - TimeUnit.MINUTES.toSeconds(TimeUnit.MILLISECONDS.toMinutes(time)))); LCMS1.BaseClearAllPeaks(); LCMS1.SetSpectrumParser(null); LCMS1.IDsummary = null; LCMS1 = null; System.gc(); } else if (mode == 2) { LCMSID IDsummary = new LCMSID("", "", ""); logger.info("Parsing all pepXML files in " + pepXMLPath + "...."); for (File file : pepXMLfolder.listFiles()) { if (file.getName().toLowerCase().endsWith("pep.xml") || file.getName().toLowerCase().endsWith("pepxml")) { PepXMLParser pepXMLParser = new PepXMLParser(IDsummary, file.getAbsolutePath(), MinProb); } } HashMap<String, LCMSID> LCMSIDMap = IDsummary.GetLCMSIDFileMap(); ExecutorService executorPool = null; executorPool = Executors.newFixedThreadPool(NoFile); logger.info("Processing all mzXML files in " + mzXMLPath + "...."); for (File file : mzXMLfolder.listFiles()) { if (file.getName().toLowerCase().endsWith("mzxml")) { LCMSID id = LCMSIDMap.get(FilenameUtils.getBaseName(file.getName())); if (id == null || id.PSMList == null) { logger.warn("No IDs found in :" + FilenameUtils.getBaseName(file.getName()) + ". Quantification for this file is skipped"); continue; } if (!id.PSMList.isEmpty()) { MS1TargetQuantThread thread = new MS1TargetQuantThread(file, id, NoCPUs, outputfolder, param); executorPool.execute(thread); } } } LCMSIDMap.clear(); LCMSIDMap = null; IDsummary = null; executorPool.shutdown(); try { executorPool.awaitTermination(Long.MAX_VALUE, TimeUnit.NANOSECONDS); } catch (InterruptedException e) { logger.info("interrupted.."); } if (outputfolder == null | outputfolder.equals("")) { outputfolder = mzXMLPath; } logger.info("Merging PSM files.."); File output = new File(outputfolder); FileWriter writer = new FileWriter(output.getAbsolutePath() + "/PSM_merge.csv"); boolean header = false; for (File csvfile : output.listFiles()) { if (csvfile.getName().toLowerCase().endsWith("_psms.csv")) { BufferedReader outreader = new BufferedReader(new FileReader(csvfile)); String outline = outreader.readLine(); if (!header) { writer.write(outline + "\n"); header = true; } while ((outline = outreader.readLine()) != null) { writer.write(outline + "\n"); } outreader.close(); csvfile.delete(); } } writer.close(); } logger.info("MS1 quant module is complete."); } catch (Exception e) { Logger.getRootLogger().error(ExceptionUtils.getStackTrace(e)); throw e; } }
From source file:edu.msu.cme.rdp.graph.utils.ContigMerger.java
public static void main(String[] args) throws IOException { final BufferedReader hmmgsResultReader; final IndexedSeqReader nuclContigReader; final double minBits; final int minProtLength; final Options options = new Options(); final PrintStream out; final ProfileHMM hmm; final FastaWriter protSeqOut; final FastaWriter nuclSeqOut; final boolean prot; final boolean all; final String shortSampleName; options.addOption("a", "all", false, "Generate all combinations for multiple paths, instead of just the best"); options.addOption("b", "min-bits", true, "Minimum bits score"); options.addOption("l", "min-length", true, "Minimum length"); options.addOption("s", "short_samplename", true, "short sample name, to be used as part of contig identifiers. This allow analyzing contigs together from different samples in downstream analysis "); options.addOption("o", "out", true, "Write output to file instead of stdout"); try {//from w w w. jav a 2s . co m CommandLine line = new PosixParser().parse(options, args); if (line.hasOption("min-bits")) { minBits = Double.valueOf(line.getOptionValue("min-bits")); } else { minBits = Double.NEGATIVE_INFINITY; } if (line.hasOption("min-length")) { minProtLength = Integer.valueOf(line.getOptionValue("min-length")); } else { minProtLength = 0; } if (line.hasOption("short_samplename")) { shortSampleName = line.getOptionValue("short_samplename") + "_"; } else { shortSampleName = ""; } if (line.hasOption("out")) { out = new PrintStream(line.getOptionValue("out")); } else { out = System.err; } all = line.hasOption("all"); args = line.getArgs(); if (args.length != 3) { throw new Exception("Unexpected number of arguments"); } hmmgsResultReader = new BufferedReader(new FileReader(new File(args[1]))); nuclContigReader = new IndexedSeqReader(new File(args[2])); hmm = HMMER3bParser.readModel(new File(args[0])); prot = (hmm.getAlphabet() == SequenceType.Protein); if (prot) { protSeqOut = new FastaWriter(new File("prot_merged.fasta")); } else { protSeqOut = null; } nuclSeqOut = new FastaWriter(new File("nucl_merged.fasta")); } catch (Exception e) { new HelpFormatter().printHelp("USAGE: ContigMerger [options] <hmm> <hmmgs_file> <nucl_contig>", options); System.err.println("Error: " + e.getMessage()); System.exit(1); throw new RuntimeException("I hate you javac"); } String line; SearchDirection lastDir = SearchDirection.left; //So this has an assumption built in //It depends on hmmgs always outputting left fragments, then right //We can't just use the kmer to figure out if we've switched to another starting point //because we allow multiple starting model pos, so two different starting //positions can have the same starting kmer Map<String, Sequence> leftContigs = new HashMap(); Map<String, Sequence> rightContigs = new HashMap(); int contigsMerged = 0; int writtenMerges = 0; long startTime = System.currentTimeMillis(); String kmer = null; String geneName = null; while ((line = hmmgsResultReader.readLine()) != null) { if (line.startsWith("#")) { continue; } String[] lexemes = line.trim().split("\t"); if (lexemes.length != 12 || lexemes[0].equals("-")) { System.err.println("Skipping line: " + line); continue; } //contig_53493 nirk 1500:6:35:16409:3561/1 ADV15048 tcggcgctctacacgttcctgcagcccggg 40 210 70 left -44.692 184 0 int index = 0; String seqid = lexemes[0]; geneName = lexemes[1]; String readid = lexemes[2]; String refid = lexemes[3]; kmer = lexemes[4]; int modelStart = Integer.valueOf(lexemes[5]); int nuclLength = Integer.valueOf(lexemes[6]); int protLength = Integer.valueOf(lexemes[7]); SearchDirection dir = SearchDirection.valueOf(lexemes[8]); if (dir != lastDir) { if (dir == SearchDirection.left) { List<MergedContig> mergedContigs = all ? mergeAllContigs(leftContigs, rightContigs, kmer, geneName, hmm) : mergeContigs(leftContigs, rightContigs, kmer, geneName, hmm); contigsMerged++; for (MergedContig mc : mergedContigs) { String mergedId = shortSampleName + geneName + "_" + mc.leftContig + "_" + mc.rightContig; out.println(mergedId + "\t" + mc.length + "\t" + mc.score); if (mc.score > minBits && mc.length > minProtLength) { if (prot) { protSeqOut.writeSeq(mergedId, mc.protSeq); } nuclSeqOut.writeSeq(mergedId, mc.nuclSeq); writtenMerges++; } } leftContigs.clear(); rightContigs.clear(); } lastDir = dir; } Sequence seq = nuclContigReader.readSeq(seqid); if (dir == SearchDirection.left) { leftContigs.put(seqid, seq); } else if (dir == SearchDirection.right) { rightContigs.put(seqid, seq); } else { throw new IOException("Cannot handle search direction " + dir); } } if (!leftContigs.isEmpty() || !rightContigs.isEmpty()) { List<MergedContig> mergedContigs = all ? mergeAllContigs(leftContigs, rightContigs, kmer, geneName, hmm) : mergeContigs(leftContigs, rightContigs, kmer, geneName, hmm); for (MergedContig mc : mergedContigs) { String mergedId = shortSampleName + mc.gene + "_" + mc.leftContig + "_" + mc.rightContig; out.println(mergedId + "\t" + mc.length + "\t" + mc.score); contigsMerged++; if (mc.score > minBits && mc.length > minProtLength) { if (prot) { protSeqOut.writeSeq(mergedId, mc.protSeq); } nuclSeqOut.writeSeq(mergedId, mc.nuclSeq); writtenMerges++; } } } out.close(); if (prot) { protSeqOut.close(); } nuclSeqOut.close(); System.err.println("Read in " + contigsMerged + " contigs, wrote out " + writtenMerges + " merged contigs in " + ((double) (System.currentTimeMillis() - startTime) / 1000) + "s"); }
From source file:hyperloglog.tools.HyperLogLogCLI.java
public static void main(String[] args) { Options options = new Options(); addOptions(options);//ww w .ja v a 2 s.c om CommandLineParser parser = new BasicParser(); CommandLine cli = null; long n = 0; long seed = 123; EncodingType enc = EncodingType.SPARSE; int p = 14; int hb = 64; boolean bitPack = true; boolean noBias = true; int unique = -1; String filePath = null; BufferedReader br = null; String outFile = null; String inFile = null; FileOutputStream fos = null; DataOutputStream out = null; FileInputStream fis = null; DataInputStream in = null; try { cli = parser.parse(options, args); if (!(cli.hasOption('n') || cli.hasOption('f') || cli.hasOption('d'))) { System.out.println("Example usage: hll -n 1000 " + "<OR> hll -f /tmp/input.txt " + "<OR> hll -d -i /tmp/out.hll"); usage(options); return; } if (cli.hasOption('n')) { n = Long.parseLong(cli.getOptionValue('n')); } if (cli.hasOption('e')) { String value = cli.getOptionValue('e'); if (value.equals(EncodingType.DENSE.name())) { enc = EncodingType.DENSE; } } if (cli.hasOption('p')) { p = Integer.parseInt(cli.getOptionValue('p')); if (p < 4 && p > 16) { System.out.println("Warning! Out-of-range value specified for p. Using to p=14."); p = 14; } } if (cli.hasOption('h')) { hb = Integer.parseInt(cli.getOptionValue('h')); } if (cli.hasOption('c')) { noBias = Boolean.parseBoolean(cli.getOptionValue('c')); } if (cli.hasOption('b')) { bitPack = Boolean.parseBoolean(cli.getOptionValue('b')); } if (cli.hasOption('f')) { filePath = cli.getOptionValue('f'); br = new BufferedReader(new FileReader(new File(filePath))); } if (filePath != null && cli.hasOption('n')) { System.out.println("'-f' (input file) specified. Ignoring -n."); } if (cli.hasOption('s')) { if (cli.hasOption('o')) { outFile = cli.getOptionValue('o'); fos = new FileOutputStream(new File(outFile)); out = new DataOutputStream(fos); } else { System.err.println("Specify output file. Example usage: hll -s -o /tmp/out.hll"); usage(options); return; } } if (cli.hasOption('d')) { if (cli.hasOption('i')) { inFile = cli.getOptionValue('i'); fis = new FileInputStream(new File(inFile)); in = new DataInputStream(fis); } else { System.err.println("Specify input file. Example usage: hll -d -i /tmp/in.hll"); usage(options); return; } } // return after deserialization if (fis != null && in != null) { long start = System.currentTimeMillis(); HyperLogLog deserializedHLL = HyperLogLogUtils.deserializeHLL(in); long end = System.currentTimeMillis(); System.out.println(deserializedHLL.toString()); System.out.println("Count after deserialization: " + deserializedHLL.count()); System.out.println("Deserialization time: " + (end - start) + " ms"); return; } // construct hll and serialize it if required HyperLogLog hll = HyperLogLog.builder().enableBitPacking(bitPack).enableNoBias(noBias).setEncoding(enc) .setNumHashBits(hb).setNumRegisterIndexBits(p).build(); if (br != null) { Set<String> hashset = new HashSet<String>(); String line; while ((line = br.readLine()) != null) { hll.addString(line); hashset.add(line); } n = hashset.size(); } else { Random rand = new Random(seed); for (int i = 0; i < n; i++) { if (unique < 0) { hll.addLong(rand.nextLong()); } else { int val = rand.nextInt(unique); hll.addLong(val); } } } long estCount = hll.count(); System.out.println("Actual count: " + n); System.out.println(hll.toString()); System.out.println("Relative error: " + HyperLogLogUtils.getRelativeError(n, estCount) + "%"); if (fos != null && out != null) { long start = System.currentTimeMillis(); HyperLogLogUtils.serializeHLL(out, hll); long end = System.currentTimeMillis(); System.out.println("Serialized hyperloglog to " + outFile); System.out.println("Serialized size: " + out.size() + " bytes"); System.out.println("Serialization time: " + (end - start) + " ms"); out.close(); } } catch (ParseException e) { System.err.println("Invalid parameter."); usage(options); } catch (NumberFormatException e) { System.err.println("Invalid type for parameter."); usage(options); } catch (FileNotFoundException e) { System.err.println("Specified file not found."); usage(options); } catch (IOException e) { System.err.println("Exception occured while reading file."); usage(options); } }
From source file:com.cws.esolutions.security.main.PasswordUtility.java
public static void main(final String[] args) { final String methodName = PasswordUtility.CNAME + "#main(final String[] args)"; if (DEBUG) {//ww w . j av a 2 s. c o m DEBUGGER.debug("Value: {}", methodName); } if (args.length == 0) { HelpFormatter usage = new HelpFormatter(); usage.printHelp(PasswordUtility.CNAME, options, true); System.exit(1); } BufferedReader bReader = null; BufferedWriter bWriter = null; try { // load service config first !! SecurityServiceInitializer.initializeService(PasswordUtility.SEC_CONFIG, PasswordUtility.LOG_CONFIG, false); if (DEBUG) { DEBUGGER.debug("Options options: {}", options); for (String arg : args) { DEBUGGER.debug("Value: {}", arg); } } CommandLineParser parser = new PosixParser(); CommandLine commandLine = parser.parse(options, args); if (DEBUG) { DEBUGGER.debug("CommandLineParser parser: {}", parser); DEBUGGER.debug("CommandLine commandLine: {}", commandLine); DEBUGGER.debug("CommandLine commandLine.getOptions(): {}", (Object[]) commandLine.getOptions()); DEBUGGER.debug("CommandLine commandLine.getArgList(): {}", commandLine.getArgList()); } final SecurityConfigurationData secConfigData = PasswordUtility.svcBean.getConfigData(); final SecurityConfig secConfig = secConfigData.getSecurityConfig(); final PasswordRepositoryConfig repoConfig = secConfigData.getPasswordRepo(); final SystemConfig systemConfig = secConfigData.getSystemConfig(); if (DEBUG) { DEBUGGER.debug("SecurityConfigurationData secConfig: {}", secConfigData); DEBUGGER.debug("SecurityConfig secConfig: {}", secConfig); DEBUGGER.debug("RepositoryConfig secConfig: {}", repoConfig); DEBUGGER.debug("SystemConfig systemConfig: {}", systemConfig); } if (commandLine.hasOption("encrypt")) { if ((StringUtils.isBlank(repoConfig.getPasswordFile())) || (StringUtils.isBlank(repoConfig.getSaltFile()))) { System.err.println("The password/salt files are not configured. Entries will not be stored!"); } File passwordFile = FileUtils.getFile(repoConfig.getPasswordFile()); File saltFile = FileUtils.getFile(repoConfig.getSaltFile()); if (DEBUG) { DEBUGGER.debug("File passwordFile: {}", passwordFile); DEBUGGER.debug("File saltFile: {}", saltFile); } final String entryName = commandLine.getOptionValue("entry"); final String username = commandLine.getOptionValue("username"); final String password = commandLine.getOptionValue("password"); final String salt = RandomStringUtils.randomAlphanumeric(secConfig.getSaltLength()); if (DEBUG) { DEBUGGER.debug("String entryName: {}", entryName); DEBUGGER.debug("String username: {}", username); DEBUGGER.debug("String password: {}", password); DEBUGGER.debug("String salt: {}", salt); } final String encodedSalt = PasswordUtils.base64Encode(salt); final String encodedUserName = PasswordUtils.base64Encode(username); final String encryptedPassword = PasswordUtils.encryptText(password, salt, secConfig.getSecretAlgorithm(), secConfig.getIterations(), secConfig.getKeyBits(), secConfig.getEncryptionAlgorithm(), secConfig.getEncryptionInstance(), systemConfig.getEncoding()); final String encodedPassword = PasswordUtils.base64Encode(encryptedPassword); if (DEBUG) { DEBUGGER.debug("String encodedSalt: {}", encodedSalt); DEBUGGER.debug("String encodedUserName: {}", encodedUserName); DEBUGGER.debug("String encodedPassword: {}", encodedPassword); } if (commandLine.hasOption("store")) { try { new File(passwordFile.getParent()).mkdirs(); new File(saltFile.getParent()).mkdirs(); boolean saltFileExists = (saltFile.exists()) ? true : saltFile.createNewFile(); if (DEBUG) { DEBUGGER.debug("saltFileExists: {}", saltFileExists); } // write the salt out first if (!(saltFileExists)) { throw new IOException("Unable to create salt file"); } boolean passwordFileExists = (passwordFile.exists()) ? true : passwordFile.createNewFile(); if (!(passwordFileExists)) { throw new IOException("Unable to create password file"); } if (commandLine.hasOption("replace")) { File[] files = new File[] { saltFile, passwordFile }; if (DEBUG) { DEBUGGER.debug("File[] files: {}", (Object) files); } for (File file : files) { if (DEBUG) { DEBUGGER.debug("File: {}", file); } String currentLine = null; File tmpFile = new File(FileUtils.getTempDirectory() + "/" + "tmpFile"); if (DEBUG) { DEBUGGER.debug("File tmpFile: {}", tmpFile); } bReader = new BufferedReader(new FileReader(file)); bWriter = new BufferedWriter(new FileWriter(tmpFile)); while ((currentLine = bReader.readLine()) != null) { if (!(StringUtils.equals(currentLine.trim().split(",")[0], entryName))) { bWriter.write(currentLine + System.getProperty("line.separator")); bWriter.flush(); } } bWriter.close(); FileUtils.deleteQuietly(file); FileUtils.copyFile(tmpFile, file); FileUtils.deleteQuietly(tmpFile); } } FileUtils.writeStringToFile(saltFile, entryName + "," + encodedUserName + "," + encodedSalt + System.getProperty("line.separator"), true); FileUtils.writeStringToFile(passwordFile, entryName + "," + encodedUserName + "," + encodedPassword + System.getProperty("line.separator"), true); } catch (IOException iox) { ERROR_RECORDER.error(iox.getMessage(), iox); } } System.out.println("Entry Name " + entryName + " stored."); } if (commandLine.hasOption("decrypt")) { String saltEntryName = null; String saltEntryValue = null; String decryptedPassword = null; String passwordEntryName = null; if ((StringUtils.isEmpty(commandLine.getOptionValue("entry")) && (StringUtils.isEmpty(commandLine.getOptionValue("username"))))) { throw new ParseException("No entry or username was provided to decrypt."); } if (StringUtils.isEmpty(commandLine.getOptionValue("username"))) { throw new ParseException("no entry provided to decrypt"); } String entryName = commandLine.getOptionValue("entry"); String username = commandLine.getOptionValue("username"); if (DEBUG) { DEBUGGER.debug("String entryName: {}", entryName); DEBUGGER.debug("String username: {}", username); } File passwordFile = FileUtils.getFile(repoConfig.getPasswordFile()); File saltFile = FileUtils.getFile(repoConfig.getSaltFile()); if (DEBUG) { DEBUGGER.debug("File passwordFile: {}", passwordFile); DEBUGGER.debug("File saltFile: {}", saltFile); } if ((!(saltFile.canRead())) || (!(passwordFile.canRead()))) { throw new IOException( "Unable to read configured password/salt file. Please check configuration and/or permissions."); } for (String lineEntry : FileUtils.readLines(saltFile, systemConfig.getEncoding())) { saltEntryName = lineEntry.split(",")[0]; if (DEBUG) { DEBUGGER.debug("String saltEntryName: {}", saltEntryName); } if (StringUtils.equals(saltEntryName, entryName)) { saltEntryValue = PasswordUtils.base64Decode(lineEntry.split(",")[2]); break; } } if (StringUtils.isEmpty(saltEntryValue)) { throw new SecurityException("No entries were found that matched the provided information"); } for (String lineEntry : FileUtils.readLines(passwordFile, systemConfig.getEncoding())) { passwordEntryName = lineEntry.split(",")[0]; if (DEBUG) { DEBUGGER.debug("String passwordEntryName: {}", passwordEntryName); } if (StringUtils.equals(passwordEntryName, saltEntryName)) { String decodedPassword = PasswordUtils.base64Decode(lineEntry.split(",")[2]); decryptedPassword = PasswordUtils.decryptText(decodedPassword, saltEntryValue, secConfig.getSecretAlgorithm(), secConfig.getIterations(), secConfig.getKeyBits(), secConfig.getEncryptionAlgorithm(), secConfig.getEncryptionInstance(), systemConfig.getEncoding()); break; } } if (StringUtils.isEmpty(decryptedPassword)) { throw new SecurityException("No entries were found that matched the provided information"); } System.out.println(decryptedPassword); } else if (commandLine.hasOption("encode")) { System.out.println(PasswordUtils.base64Encode((String) commandLine.getArgList().get(0))); } else if (commandLine.hasOption("decode")) { System.out.println(PasswordUtils.base64Decode((String) commandLine.getArgList().get(0))); } } catch (IOException iox) { ERROR_RECORDER.error(iox.getMessage(), iox); System.err.println("An error occurred during processing: " + iox.getMessage()); System.exit(1); } catch (ParseException px) { ERROR_RECORDER.error(px.getMessage(), px); System.err.println("An error occurred during processing: " + px.getMessage()); System.exit(1); } catch (SecurityException sx) { ERROR_RECORDER.error(sx.getMessage(), sx); System.err.println("An error occurred during processing: " + sx.getMessage()); System.exit(1); } catch (SecurityServiceException ssx) { ERROR_RECORDER.error(ssx.getMessage(), ssx); System.exit(1); } finally { try { if (bReader != null) { bReader.close(); } if (bWriter != null) { bReader.close(); } } catch (IOException iox) { } } System.exit(0); }
From source file:com.pari.nm.utils.backup.BackupRestore.java
/** * @param args/*from w w w .j a v a 2 s. c om*/ */ public static void main(String[] args) { com.maverick.ssh.LicenseManager.addLicense("----BEGIN 3SP LICENSE----\r\n" + "Product : J2SSH Maverick\r\n" + "Licensee: Pari Networks Inc.\r\n" + "Comments: Sreenivas Devalla\r\n" + "Type : Foundation License\r\n" + "Created : 20-Jun-2007\r\n" + "\r\n" + "3787201A027FCA5BA600F3CF9CCEF4C85068187D70F94ABC\r\n" + "E7D7280AAFB06CE499DC968A4CB25795475D5B79FDDD6CB4\r\n" + "7971A60E947E84A4DADFAB2F89E2F52470182ED2EF429A2F\r\n" + "2EC6D8B49CAF167605A7F56C4EB736ECA7150819FCF04DC6\r\n" + "01B1404EA9BC83BEAA4AB2F4FC7AB344BEC08CF9DDDAAA34\r\n" + "EC80C1C14FA8BB1A8B47E86D393FAECD3C0E7C450E0D1FE3\r\n" + "----END 3SP LICENSE----\r\n"); String mode = null; BufferedReader br = null; if (args.length < 9) { System.err.println("BackUpDatabase: Invalid Syntax."); System.err.println( "Usage - java BackUpDatabase <ftpserver> <ftpuser> <ftppassword> <ftpdir> <ftpfile> <localdir> <backup | recovery> "); System.exit(-1); } try { mode = args[8]; System.out.println("Request received with mode :" + mode + "\n"); // BackupRestore tbk = BackupRestore.getInstance(); BackupRestore tbk = new BackupRestore(); if ((mode != null) && (mode.length() > 0) && mode.equalsIgnoreCase("recovery")) { File restoreDir = new File(args[7], args[6].substring(0, args[6].length() - 4)); System.out.println("Restore Directory :" + restoreDir + "\n"); if (!restoreDir.exists()) { try { FTPServerType serverType = FTPServerType.valueOf(FTPServerType.class, args[0]); System.out.println("Fetching the backup File :" + args[6] + "\n"); System.out.println("Please wait, it may take sometime....." + "\n"); if (tbk.fetchAndExtractBackupFile(serverType, args[1], Integer.parseInt(args[2]), args[3], args[4], args[5], args[6], args[7]) == null) { System.err.println("Error : Failed to fetch the backup File.\n"); System.exit(-1); } System.out.println("Successfully fetched the backup File :" + args[6] + "\n"); } catch (Exception e) { System.out.println( "Error : Exception while fetching the backup file.Failed to restore the backup File.\n"); e.printStackTrace(); System.exit(-1); } } try { Thread.sleep(10000); } catch (Exception ee) { ee.printStackTrace(); } System.out.println("Starting recovery ...\n"); if (!File.separator.equals("\\")) { System.out.println("Stopping the Pari Server process.\n"); Process p = Runtime.getRuntime().exec("killall -9 pari_server"); MyReader min = new MyReader(p.getInputStream()); MyReader merr = new MyReader(p.getErrorStream()); try { min.join(20000); } catch (Exception ee) { } try { merr.join(20000); } catch (Exception ex) { } } if (!File.separator.equals("\\")) { System.out.println("Stopping the Pari Server process.\n"); // Process p = Runtime.getRuntime().exec("killall -9 pari_server"); Process p = Runtime.getRuntime().exec("/etc/init.d/dash stop"); MyReader min = new MyReader(p.getInputStream()); MyReader merr = new MyReader(p.getErrorStream()); try { min.join(20000); } catch (Exception ee) { } try { merr.join(20000); } catch (Exception ex) { } } System.out.println("Start recovering the backup file.\n"); if (tbk.doRecovery(args[0], args[1], args[2], args[3], args[4], args[5], args[6], args[7])) { System.out.println("Done recovering...\n"); validateCSPCInstanace(); } else { System.out.println("Failed to recover the backup File...\n"); } try { Process p = null; String cmd = ""; if (File.separator == "\\") { cmd = "cmd /k start_server.cmd > pari.out 2>&1"; } else { cmd = "/etc/init.d/dash start"; } System.err.println(cmd); Runtime.getRuntime().exec(cmd); Boolean flag = false; int count = 0; String[] nccmStatusCheckCmd = { "/bin/sh", "-c", "netstat -an | grep 42605 | grep LISTEN | wc -l" }; do { count++; Thread.sleep(60000); // The command output will be 1 if NCCM server started and Listening on port 42605 otherwise it // will return 0 p = Runtime.getRuntime().exec(nccmStatusCheckCmd); int ex = -1; try { ex = p.waitFor(); } catch (InterruptedException e) { System.out.println("Normal execution, exception: " + e); } System.out.println("Normal execution, exit value: " + ex); br = new BufferedReader(new InputStreamReader(p.getInputStream())); String thisLine = null; while ((thisLine = br.readLine()) != null) { System.out.println("Command Execution Result:" + thisLine); if (thisLine.equals("1")) { flag = true; break; } } System.out.println("Count - " + count); BufferedReader error = new BufferedReader(new InputStreamReader(p.getErrorStream())); while ((thisLine = error.readLine()) != null) { System.out.println(thisLine); } } while ((!flag) && count < 30); if (flag) { // System.out.println("NCCM Server came to listening state: after " + count + " mins"); // Runtime.getRuntime().exec("sh $DASH_HOME/webui/tomcat/bin/shutdown.sh"); Thread.sleep(60000); System.out.println("NCCM Server came to listening state: after " + count + " mins"); // Runtime.getRuntime().exec("sh $DASH_HOME/webui/tomcat/bin/startup.sh"); } else { System.out.println("NCCM Server didn't come to listening state: last " + count + " mins"); System.out.println("Please verify NCCM Server and start tomcat server manually."); } System.exit(1); } catch (Exception ee) { ee.printStackTrace(); } } else if ((mode != null) && (mode.length() > 0) && mode.equalsIgnoreCase("ftplist")) { PariFTP pftp = new PariFTP("10.100.1.20", "guest", "guest", "/"); String[] list = pftp.getRemoteListing(); System.out.println("List of Files\n"); for (int i = 0; (list != null) && (i < list.length); i++) { System.out.println(list[i] + "\n"); } } else { System.out.println("Mode \t" + mode + "\t not supported\n"); } System.exit(-1); } catch (Exception e) { e.printStackTrace(); } finally { try { if (br != null) { br.close(); } } catch (Exception ex) { ex.printStackTrace(); } } }
From source file:WebReader.java
static void getData(String address) throws Exception { URL page = new URL(address); StringBuffer text = new StringBuffer(); HttpURLConnection conn = (HttpURLConnection) page.openConnection(); conn.connect();/*from www.j av a 2 s . c om*/ InputStreamReader in = new InputStreamReader((InputStream) conn.getContent()); BufferedReader buff = new BufferedReader(in); String line = buff.readLine(); while (line != null) { text.append(line + "\n"); line = buff.readLine(); } System.out.println(text.toString()); }
From source file:JarRead.java
private static void process(InputStream input) throws IOException { InputStreamReader isr = new InputStreamReader(input); BufferedReader reader = new BufferedReader(isr); String line;/*ww w . j a va 2 s . c om*/ while ((line = reader.readLine()) != null) { System.out.println(line); } reader.close(); }
From source file:Main.java
private static void readFile(String fileName) throws Exception { File file = new File(fileName); FileReader reader = new FileReader(file); BufferedReader in = new BufferedReader(reader); String string;//from ww w . j ava 2 s . c om while ((string = in.readLine()) != null) { System.out.println(string); } in.close(); }
From source file:Main.java
public static int numberBounce(PrintWriter out, BufferedReader in) { try {/*w ww . j av a2 s .co m*/ String theString = in.readLine(); if (theString != null) { int num = Integer.parseInt(theString); ++num; out.println("" + num); return num; } } catch (IOException e) { Log.e("NUMBER_BOUNCE_METHOD", e.getMessage()); } return -1; }