Example usage for org.apache.hadoop.io Text clear

List of usage examples for org.apache.hadoop.io Text clear

Introduction

In this page you can find the example usage for org.apache.hadoop.io Text clear.

Prototype

public void clear() 

Source Link

Document

Clear the string to empty.

Usage

From source file:org.springframework.yarn.batch.item.LineReader.java

License:Apache License

/**
 * Read a line terminated by a custom delimiter.
 */// w w  w  .ja v a  2  s  .co  m
private int readCustomLine(Text str, int maxLineLength, int maxBytesToConsume) throws IOException {
    /*
     * We're reading data from inputStream, but the head of the stream may
     * be already captured in the previous buffer, so we have several cases:
     *
     * 1. The buffer tail does not contain any character sequence which
     * matches with the head of delimiter. We count it as a ambiguous byte
     * count = 0
     *
     * 2. The buffer tail contains a X number of characters, that forms a
     * sequence, which matches with the head of delimiter. We count
     * ambiguous byte count = X
     *
     * // *** eg: A segment of input file is as follows
     *
     * " record 1792: I found this bug very interesting and I have
     * completely read about it. record 1793: This bug can be solved easily
     * record 1794: This ."
     *
     * delimiter = "record";
     *
     * supposing:- String at the end of buffer =
     * "I found this bug very interesting and I have completely re" There
     * for next buffer = "ad about it. record 179       ...."
     *
     * The matching characters in the input buffer tail and delimiter head =
     * "re" Therefore, ambiguous byte count = 2 **** //
     *
     * 2.1 If the following bytes are the remaining characters of the
     * delimiter, then we have to capture only up to the starting position
     * of delimiter. That means, we need not include the ambiguous
     * characters in str.
     *
     * 2.2 If the following bytes are not the remaining characters of the
     * delimiter ( as mentioned in the example ), then we have to include
     * the ambiguous characters in str.
     */
    str.clear();
    int txtLength = 0; // tracks str.getLength(), as an optimization
    long bytesConsumed = 0;
    int delPosn = 0;
    int ambiguousByteCount = 0; // To capture the ambiguous characters count
    do {
        int startPosn = bufferPosn; // Start from previous end position
        if (bufferPosn >= bufferLength) {
            startPosn = bufferPosn = 0;
            bufferLength = in.read(buffer);
            if (bufferLength <= 0) {
                str.append(recordDelimiterBytes, 0, ambiguousByteCount);
                break; // EOF
            }
        }
        for (; bufferPosn < bufferLength; ++bufferPosn) {
            if (buffer[bufferPosn] == recordDelimiterBytes[delPosn]) {
                delPosn++;
                if (delPosn >= recordDelimiterBytes.length) {
                    bufferPosn++;
                    break;
                }
            } else if (delPosn != 0) {
                bufferPosn--;
                delPosn = 0;
            }
        }
        int readLength = bufferPosn - startPosn;
        bytesConsumed += readLength;
        int appendLength = readLength - delPosn;
        if (appendLength > maxLineLength - txtLength) {
            appendLength = maxLineLength - txtLength;
        }
        if (appendLength > 0) {
            if (ambiguousByteCount > 0) {
                str.append(recordDelimiterBytes, 0, ambiguousByteCount);
                // appending the ambiguous characters (refer case 2.2)
                bytesConsumed += ambiguousByteCount;
                ambiguousByteCount = 0;
            }
            str.append(buffer, startPosn, appendLength);
            txtLength += appendLength;
        }
        if (bufferPosn >= bufferLength) {
            if (delPosn > 0 && delPosn < recordDelimiterBytes.length) {
                ambiguousByteCount = delPosn;
                bytesConsumed -= ambiguousByteCount; // to be consumed in
                // next
            }
        }
    } while (delPosn < recordDelimiterBytes.length && bytesConsumed < maxBytesToConsume);
    if (bytesConsumed > (long) Integer.MAX_VALUE) {
        throw new IOException("Too many bytes before delimiter: " + bytesConsumed);
    }
    return (int) bytesConsumed;
}

From source file:StorageEngineClient.MyLineReader.java

License:Open Source License

public int readLine(Text str, int maxLineLength, int maxBytesToConsume) throws IOException {

    str.clear();
    int txtLength = 0;
    int newlineLength = 0;
    boolean prevCharCR = false;
    long bytesConsumed = 0;
    do {//from  ww w  . j  a  v  a 2  s . c om
        int startPosn = bufferPosn;
        if (bufferPosn >= bufferLength) {
            startPosn = bufferPosn = 0;
            if (prevCharCR)
                ++bytesConsumed;
            bufferLength = in.read(buffer);
            if (bufferLength <= 0)
                break;
        }
        for (; bufferPosn < bufferLength; ++bufferPosn) {
            if (buffer[bufferPosn] == LF) {
                newlineLength = (prevCharCR && lineendmode != 2) ? 2 : 1;
                ++bufferPosn;
                break;
            }
            if (prevCharCR) {
                if (lineendmode == 0) {
                    newlineLength = 1;
                    break;
                }
            }
            prevCharCR = (buffer[bufferPosn] == CR);
        }
        int readLength = bufferPosn - startPosn;
        if (prevCharCR && newlineLength == 0)
            --readLength;
        bytesConsumed += readLength;
        int appendLength = readLength - newlineLength;
        if (appendLength > maxLineLength - txtLength) {
            appendLength = maxLineLength - txtLength;
        }
        if (appendLength > 0) {
            str.append(buffer, startPosn, appendLength);
            txtLength += appendLength;
        }
    } while (newlineLength == 0 && bytesConsumed < maxBytesToConsume);

    if (bytesConsumed > (long) Integer.MAX_VALUE)
        throw new IOException("Too many bytes before newline: " + bytesConsumed);
    return (int) bytesConsumed;
}

From source file:tests.it.crs4.seal.common.TestTextSamMapping.java

License:Open Source License

@Test
public void testDontDependOnOriginalData() {
    Text source = new Text(sam);
    TextSamMapping map = new TextSamMapping(source);
    source.set("zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz");
    source.clear();
    assertEquals("AGCTTCTTTGACTCTCGAATTTTAGCACTAGAAGAAATAGTGAGGATTATATATTTCAGAAGTTCTCACCCAGGATATCAGAACACATTCA",
            map.getSequenceString());//from   w  w  w  .j  av  a2s .  c  o  m
}

From source file:trec.MyLineReader.java

License:Apache License

/**
 * Read one line from the InputStream into the given Text.  A line
 * can be terminated by one of the following: '\n' (LF) , '\r' (CR),
 * or '\r\n' (CR+LF).  EOF also terminates an otherwise unterminated
 * line./*w  w w  .j a va  2s.c o  m*/
 *
 * @param str the object to store the given line (without newline)
 * @param maxLineLength the maximum number of bytes to store into str;
 *  the rest of the line is silently discarded.
 * @param maxBytesToConsume the maximum number of bytes to consume
 *  in this call.  This is only a hint, because if the line cross
 *  this threshold, we allow it to happen.  It can overshoot
 *  potentially by as much as one buffer length.
 *
 * @return the number of bytes read including the (longest) newline
 * found.
 *
 * @throws IOException if the underlying stream throws
 */
public int readLine(Text str, int maxLineLength, int maxBytesToConsume) throws IOException {
    /* We're reading data from in, but the head of the stream may be
     * already buffered in buffer, so we have several cases:
     * 1. No newline characters are in the buffer, so we need to copy
     *    everything and read another buffer from the stream.
     * 2. An unambiguously terminated line is in buffer, so we just
     *    copy to str.
     * 3. Ambiguously terminated line is in buffer, i.e. buffer ends
     *    in CR.  In this case we copy everything up to CR to str, but
     *    we also need to see what follows CR: if it's LF, then we
     *    need consume LF as well, so next call to readLine will read
     *    from after that.
     * We use a flag prevCharCR to signal if previous character was CR
     * and, if it happens to be at the end of the buffer, delay
     * consuming it until we have a chance to look at the char that
     * follows.
     */
    str.clear();
    int txtLength = 0; //tracks str.getLength(), as an optimization
    int newlineLength = 0; //length of terminating newline
    boolean prevCharCR = false; //true of prev char was CR
    long bytesConsumed = 0;
    do {
        int startPosn = bufferPosn; //starting from where we left off the last time
        if (bufferPosn >= bufferLength) {
            startPosn = bufferPosn = 0;
            if (prevCharCR)
                ++bytesConsumed; //account for CR from previous read
            bufferLength = in.read(buffer);
            if (bufferLength <= 0)
                break; // EOF
        }
        for (; bufferPosn < bufferLength; ++bufferPosn) { //search for newline
            if (buffer[bufferPosn] == LF) {
                newlineLength = (prevCharCR) ? 2 : 1;
                ++bufferPosn; // at next invocation proceed from following byte
                break;
            }
            if (prevCharCR) { //CR + notLF, we are at notLF
                newlineLength = 1;
                break;
            }
            prevCharCR = (buffer[bufferPosn] == CR);
        }
        int readLength = bufferPosn - startPosn;
        if (prevCharCR && newlineLength == 0)
            --readLength; //CR at the end of the buffer
        bytesConsumed += readLength;
        int appendLength = readLength - newlineLength;
        if (appendLength > maxLineLength - txtLength) {
            appendLength = maxLineLength - txtLength;
        }
        if (appendLength > 0) {
            str.append(buffer, startPosn, appendLength);
            txtLength += appendLength;
            //throw new IOException("size="+buffer.length);
        }
    } while (newlineLength == 0 && bytesConsumed < maxBytesToConsume);

    if (bytesConsumed > (long) Integer.MAX_VALUE)
        throw new IOException("Too many bytes before newline: " + bytesConsumed);
    return (int) bytesConsumed;
}