Example usage for org.apache.commons.io FileUtils openInputStream

List of usage examples for org.apache.commons.io FileUtils openInputStream

  1. HOME
  2. Java
  3. org.apache.commons
  4. org.apache.commons.io.*
  5. FileUtils
  6. openInputStream

Introduction

In this page you can find the example usage for org.apache.commons.io FileUtils openInputStream.

Prototype

public static FileInputStream openInputStream(File file) throws IOException

Source Link

Document

Opens a FileInputStream for the specified file, providing better error messages than simply calling new FileInputStream(file).

Usage

From source file:eu.apenet.dpt.standalone.gui.eaccpf.EacCpfFrame.java

public void createFrame(File eacFile, boolean isNew) {
    try {/*  w w  w . ja v  a2  s. com*/
        createFrame(FileUtils.openInputStream(eacFile), isNew);
    } catch (Exception e) {
        e.printStackTrace();
    }
}

From source file:com.l2jserver.service.core.logging.TruncateToZipFileAppender.java

/**
 * This method creates archive with file instead of deleting it.
 * //from www.  j av  a2 s  . c o  m
 * @param file
 *            file to truncate
 */
protected void truncate(File file) {
    LogLog.debug("Compression of file: " + file.getAbsolutePath() + " started.");

    // Linux systems doesn't provide file creation time, so we have to hope
    // that log files
    // were not modified manually after server starup
    // We can use here Windowns-only solution but that suck :(
    if (FileUtils.isFileOlder(file, ManagementFactory.getRuntimeMXBean().getStartTime())) {
        File backupRoot = new File(getBackupDir());
        if (!backupRoot.exists() && !backupRoot.mkdirs()) {
            throw new Error("Can't create backup dir for backup storage");
        }

        SimpleDateFormat df;
        try {
            df = new SimpleDateFormat(getBackupDateFormat());
        } catch (Exception e) {
            throw new Error("Invalid date formate for backup files: " + getBackupDateFormat(), e);
        }
        String date = df.format(new Date(file.lastModified()));

        File zipFile = new File(backupRoot, file.getName() + "." + date + ".zip");

        ZipOutputStream zos = null;
        FileInputStream fis = null;
        try {
            zos = new ZipOutputStream(new FileOutputStream(zipFile));
            ZipEntry entry = new ZipEntry(file.getName());
            entry.setMethod(ZipEntry.DEFLATED);
            entry.setCrc(FileUtils.checksumCRC32(file));
            zos.putNextEntry(entry);
            fis = FileUtils.openInputStream(file);

            byte[] buffer = new byte[1024];
            int readed;
            while ((readed = fis.read(buffer)) != -1) {
                zos.write(buffer, 0, readed);
            }

        } catch (Exception e) {
            throw new Error("Can't create zip file", e);
        } finally {
            if (zos != null) {
                try {
                    zos.close();
                } catch (IOException e) {
                    // not critical error
                    LogLog.warn("Can't close zip file", e);
                }
            }

            if (fis != null) {
                try {
                    // not critical error
                    fis.close();
                } catch (IOException e) {
                    LogLog.warn("Can't close zipped file", e);
                }
            }
        }

        if (!file.delete()) {
            throw new Error("Can't delete old log file " + file.getAbsolutePath());
        }
    }
}

From source file:com.silverpeas.sharing.servlets.GetLinkFileServlet.java

@Override
protected void service(HttpServletRequest request, HttpServletResponse response)
        throws ServletException, IOException {
    RestRequest rest = new RestRequest(request, "myFile");
    String keyFile = rest.getElementValue(PARAM_KEYFILE);
    Ticket ticket = SharingServiceFactory.getSharingTicketService().getTicket(keyFile);
    if (ticket != null && ticket.isValid()) {
        // recherche des infos sur le fichier...
        String filePath = null;// w ww  .  ja va 2s .  co m
        String fileType = null;
        String fileName = null;
        long fileSize = 0;
        if (ticket instanceof SimpleFileTicket) {
            SimpleDocumentPK pk = new SimpleDocumentPK(null, ticket.getComponentId());
            pk.setOldSilverpeasId(ticket.getSharedObjectId());
            SimpleDocument document = AttachmentServiceFactory.getAttachmentService().searchDocumentById(pk,
                    null);
            filePath = document.getAttachmentPath();
            fileType = document.getContentType();
            fileName = document.getFilename();
            fileSize = document.getSize();
        } else if (ticket instanceof VersionFileTicket) {
            SimpleDocumentPK pk = new SimpleDocumentPK(null, ticket.getComponentId());
            pk.setOldSilverpeasId(ticket.getSharedObjectId());
            HistorisedDocument versionedDocument = (HistorisedDocument) AttachmentServiceFactory
                    .getAttachmentService().searchDocumentById(pk, null);
            SimpleDocument document = versionedDocument.getLastPublicVersion();
            filePath = document.getAttachmentPath();
            fileType = document.getContentType();
            fileName = document.getFilename();
            fileSize = document.getSize();
        }
        File realFile = new File(filePath);
        BufferedInputStream input = null;
        OutputStream out = response.getOutputStream();
        try {
            response.setContentType(fileType);
            response.setHeader("Content-Disposition", "inline; filename=\"" + fileName + "\"");
            response.setHeader("Content-Length", String.valueOf(fileSize));
            input = new BufferedInputStream(FileUtils.openInputStream(realFile));
            IOUtils.copy(input, out);
            DownloadDetail download = new DownloadDetail(ticket, new Date(), request.getRemoteAddr());
            SharingServiceFactory.getSharingTicketService().addDownload(download);
            return;
        } catch (Exception ignored) {
        } finally {
            if (input != null) {
                IOUtils.closeQuietly(input);
            }
            IOUtils.closeQuietly(out);
        }
    }
    getServletContext().getRequestDispatcher("/sharing/jsp/invalidTicket.jsp").forward(request, response);
}

From source file:com.aionemu.commons.log4j.appenders.TruncateToZipFileAppender.java

/**
 * This method creates archive with file instead of deleting it.
 *
 * @param file file to truncate// www  .  j a v  a2s  .c  o  m
 */
protected void truncate(File file) {
    LogLog.debug("Compression of file: " + file.getAbsolutePath() + " started.");

    // Linux systems doesn't provide file creation time, so we have to hope
    // that log files
    // were not modified manually after server starup
    // We can use here Windowns-only solution but that suck :(
    if (FileUtils.isFileOlder(file, ManagementFactory.getRuntimeMXBean().getStartTime())) {
        File backupRoot = new File(getBackupDir());
        if (!backupRoot.exists() && !backupRoot.mkdirs()) {
            throw new AppenderInitializationError("Can't create backup dir for backup storage");
        }

        SimpleDateFormat df;
        try {
            df = new SimpleDateFormat(getBackupDateFormat());
        } catch (Exception e) {
            throw new AppenderInitializationError(
                    "Invalid date formate for backup files: " + getBackupDateFormat(), e);
        }
        String date = df.format(new Date(file.lastModified()));

        File zipFile = new File(backupRoot, file.getName() + "." + date + ".zip");

        ZipOutputStream zos = null;
        FileInputStream fis = null;
        try {
            zos = new ZipOutputStream(new FileOutputStream(zipFile));
            ZipEntry entry = new ZipEntry(file.getName());
            entry.setMethod(ZipEntry.DEFLATED);
            entry.setCrc(FileUtils.checksumCRC32(file));
            zos.putNextEntry(entry);
            fis = FileUtils.openInputStream(file);

            byte[] buffer = new byte[1024];
            int readed;
            while ((readed = fis.read(buffer)) != -1) {
                zos.write(buffer, 0, readed);
            }

        } catch (Exception e) {
            throw new AppenderInitializationError("Can't create zip file", e);
        } finally {
            if (zos != null) {
                try {
                    zos.close();
                } catch (IOException e) {
                    // not critical error
                    LogLog.warn("Can't close zip file", e);
                }
            }

            if (fis != null) {
                try {
                    // not critical error
                    fis.close();
                } catch (IOException e) {
                    LogLog.warn("Can't close zipped file", e);
                }
            }
        }

        if (!file.delete()) {
            throw new AppenderInitializationError("Can't delete old log file " + file.getAbsolutePath());
        }
    }
}

From source file:gov.nih.nci.caarray.application.fileaccess.FileAccessServiceBean.java

private void readChunk(File chunk, CaArrayFile caArrayFile) {
    try {/*w w  w.ja va  2s . co m*/
        final InputStream is = FileUtils.openInputStream(chunk);
        final StorageMetadata metadata = this.dataStorageFacade.addFileChunk(caArrayFile.getDataHandle(), is);
        caArrayFile.setDataHandle(metadata.getHandle());
        caArrayFile.setPartialSize(metadata.getPartialSize());
        IOUtils.closeQuietly(is);
    } catch (final IOException e) {
        throw new FileAccessException("File " + caArrayFile.getName() + " couldn't be read", e);
    }
}

From source file:com.bandstand.web.ImagesController.java

@Get
public InputStream getImageFile(Image image) throws IOException {
    File content = new File(image.getFileName());
    return FileUtils.openInputStream(content);
}

From source file:fr.ippon.wip.config.ZipConfiguration.java

/**
 * Create a zip archive from a configuration.
 * // w  w  w  .j av a2  s  .c o  m
 * @param configuration
 *            the configuration to zip
 * @param out
 *            the stream to be used
 */
public void zip(WIPConfiguration configuration, ZipOutputStream out) {
    XMLConfigurationDAO xmlConfigurationDAO = new XMLConfigurationDAO(FileUtils.getTempDirectoryPath());

    /*
     * a configuration with the same name may already has been unzipped in
     * the temp directory, so we try to delete it for avoiding name
     * modification (see ConfigurationDAO.correctConfigurationName).
     */
    xmlConfigurationDAO.delete(configuration);
    xmlConfigurationDAO.create(configuration);

    String configName = configuration.getName();

    try {
        int[] types = new int[] { XMLConfigurationDAO.FILE_NAME_CLIPPING,
                XMLConfigurationDAO.FILE_NAME_TRANSFORM, XMLConfigurationDAO.FILE_NAME_CONFIG };
        for (int type : types) {
            File file = xmlConfigurationDAO.getConfigurationFile(configName, type);
            ZipEntry entry = new ZipEntry(file.getName());
            out.putNextEntry(entry);
            copy(FileUtils.openInputStream(file), out);
            out.closeEntry();
        }

    } catch (IOException e) {
        e.printStackTrace();
    }
}

From source file:edu.cornell.med.icb.goby.reads.TestReadsWriter.java

@Test
public void testReadFastBufferredOneChunk() throws IOException {
    final String[] sequences = { "ACTGCGCGCG", "AAAAATTTTGGGGGCCCCCCC",
            "AAAAATTTTGGGGGCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC" };
    final String[] descriptions = { "hello world", "descr2", "description 3" };
    final String filename = "test-results/reads/written-101.bin";

    final ReadsWriter writer = new ReadsWriterImpl(new FileOutputStream(new File(filename)));
    ReadsReader reader;//  w  ww .ja v a2  s . c o  m

    int expectedCount = 0;
    writer.setNumEntriesPerChunk(9);
    final int totalNumSeqs = 13;
    for (int i = 0; i < totalNumSeqs; i++) {
        int j = 0;
        for (final String sequence : sequences) {
            writer.setSequence(sequence);
            writer.setDescription(descriptions[j]);
            writer.appendEntry();
            ++j;
            expectedCount++;
        }
    }
    writer.close();

    FastBufferedInputStream stream = new FastBufferedInputStream(FileUtils.openInputStream(new File(filename)));
    // start at 10 and end at 15 should return no sequences at all.
    reader = new ReadsReader(10, 15, stream);
    MutableString sequence = new MutableString();
    assertFalse(reader.hasNext());

    stream = new FastBufferedInputStream(FileUtils.openInputStream(new File(filename)));
    // start at 138 (precise start of a chunk) and end at 139 should return 9 sequences exactly.
    reader = new ReadsReader(138, 139, stream);
    sequence = new MutableString();
    int count = 0;

    while (reader.hasNext()) {
        final Reads.ReadEntry entry = reader.next();
        ReadsReader.decodeSequence(entry, sequence);
        // check that the sequence matches what was encoded:
        assertEquals(sequences[count % sequences.length], sequence.toString());
        assertEquals(descriptions[count % descriptions.length], entry.getDescription());
        //  assertEquals(count+9, entry.getReadIndex());
        //        System.out.println("desc: " +entry.getDescription() );
        count++;
    }
    // should have skipped 2:
    assertEquals(9, count);
}

From source file:net.frogmouth.ddf.jpeginputtransformer.TestJpegInputTransformer.java

@Test()
public void testSonyDSCHXV5() throws IOException, CatalogTransformerException, UnsupportedQueryException,
        SourceUnavailableException, FederationException, ParseException {
    File file = new File(TEST_DATA_PATH + "Sony DSC-HX5V.jpg");
    FileInputStream fis = FileUtils.openInputStream(file);
    Metacard metacard = createTransformer().transform(fis);

    assertNotNull(metacard);//from w ww  .j  a v  a2 s. co m

    assertNotNull(metacard.getCreatedDate());
    assertThat(metacard.getCreatedDate().getYear() + 1900, is(2010));
    assertThat(metacard.getCreatedDate().getMonth() + 1, is(7));
    assertThat(metacard.getCreatedDate().getDate(), is(14));
    assertThat(metacard.getCreatedDate().getHours(), is(11));
    assertThat(metacard.getCreatedDate().getMinutes(), is(00));
    assertThat(metacard.getCreatedDate().getSeconds(), is(23));

    assertNotNull(metacard.getModifiedDate());
    assertThat(metacard.getModifiedDate().getYear() + 1900, is(2010));
    assertThat(metacard.getModifiedDate().getMonth() + 1, is(7));
    assertThat(metacard.getModifiedDate().getDate(), is(14));
    assertThat(metacard.getModifiedDate().getHours(), is(11));
    assertThat(metacard.getModifiedDate().getMinutes(), is(00));
    assertThat(metacard.getModifiedDate().getSeconds(), is(23));

    WKTReader reader = new WKTReader();
    Geometry geometry = reader.read(metacard.getLocation());
    assertEquals(-104.303846389, geometry.getCoordinate().x, 0.00001);
    assertEquals(39.5698783333, geometry.getCoordinate().y, 0.00001);

    byte[] thumbnail = metacard.getThumbnail();
    assertNotNull(thumbnail);
    assertThat(thumbnail.length, is(11490));
}

From source file:de.iteratec.iteraplan.businesslogic.exchange.legacyExcel.ExcelWorkbook.java

/**
 * Load a workbook from a given template type and template filename
 *//* www .j  a  v  a  2 s  . c  om*/
protected void loadWorkbookFromTemplateFileName(TemplateType templateTypeParameter,
        String assignedTemplateFileName) {

    LOGGER.debug("Loading Template as Input File [" + assignedTemplateFileName + "]");

    this.templateType = templateTypeParameter;

    String templateFileName;
    if (assignedTemplateFileName.isEmpty()) {
        templateFileName = getDefaultTemplateForTemplateType();
    } else {
        templateFileName = assignedTemplateFileName;
    }

    File templateFile = templateLocatorService.getFile(templateType, templateFileName);

    InputStream is = null;

    try {
        is = FileUtils.openInputStream(templateFile);
    } catch (FileNotFoundException e) {
        String msg = String.format("The template file %s could not be found", templateFile);
        LOGGER.error(msg, e);
        throw new IteraplanBusinessException(IteraplanErrorMessages.INVALID_EXCEL_TEMPLATE, msg, e);
    } catch (IOException e) {
        String msg = String.format("The template file %s is a directory or could not be read", templateFile);
        LOGGER.error(msg, e);
        throw new IteraplanBusinessException(IteraplanErrorMessages.INVALID_EXCEL_TEMPLATE, msg, e);
    }

    loadWorkbookFromInputStream(is);
}