List of usage examples for java.lang Integer valueOf
@HotSpotIntrinsicCandidate public static Integer valueOf(int i)
From source file:com.esri.geoevent.test.tools.RunTcpInBdsOutTest.java
public static void main(String args[]) { // Example Command line args //-n 10000 -g w12ags104a.jennings.home -i 5565 -m https://w12ags104a.jennings.home/arcgis/rest/services/Hosted/FAA-Stream/MapServer/0 -f D:\github\performance-test-harness-for-geoevent\app\simulations\faa-stream.csv -r 1000,3000,1000 int numberEvents = 10000; // Number of Events String gisServer = "w12ags104a.jennings.home"; // GIS Server int inputTcpPort = 5565; // TCP Input Port String msLayerUrl = "http://w12ags104a.jennings.home/arcgis/rest/services/Hosted/FAA-Stream/MapServer/0"; String EventsInputFile = "D:\\github\\performance-test-harness-for-geoevent\\app\\simulations\\faa-stream.csv"; // Events input File int start_rate = 5000; int end_rate = 5005; int rate_step = 1; Options opts = new Options(); opts.addOption("n", true, "Number of Events"); opts.addOption("g", true, "GIS Server"); opts.addOption("i", true, "Input TCP Port"); opts.addOption("m", true, "Map Service Layer URL"); opts.addOption("f", true, "File with GeoEvents to Send"); opts.addOption("r", true, "Rates to test Start,End,Step"); opts.addOption("h", false, "Help"); try {/*from ww w . ja v a 2 s .c o m*/ CommandLineParser parser = new BasicParser(); CommandLine cmd = null; try { cmd = parser.parse(opts, args, false); } catch (org.apache.commons.cli.ParseException ignore) { System.err.println(ignore.getMessage()); } String cmdInputErrorMsg = ""; if (cmd.getOptions().length == 0 || cmd.hasOption("h")) { throw new org.apache.commons.cli.ParseException("Show Help"); } if (cmd.hasOption("n")) { String val = cmd.getOptionValue("n"); try { numberEvents = Integer.valueOf(val); } catch (NumberFormatException e) { cmdInputErrorMsg += "Invalid value for n. Must be integer.\n"; } } if (cmd.hasOption("g")) { gisServer = cmd.getOptionValue("g"); } if (cmd.hasOption("i")) { String val = cmd.getOptionValue("i"); try { inputTcpPort = Integer.valueOf(val); } catch (NumberFormatException e) { cmdInputErrorMsg += "Invalid value for i. Must be integer.\n"; } } if (cmd.hasOption("m")) { msLayerUrl = cmd.getOptionValue("m"); } if (cmd.hasOption("f")) { EventsInputFile = cmd.getOptionValue("f"); } if (cmd.hasOption("r")) { String val = cmd.getOptionValue("r"); try { String parts[] = val.split(","); if (parts.length == 3) { start_rate = Integer.parseInt(parts[0]); end_rate = Integer.parseInt(parts[1]); rate_step = Integer.parseInt(parts[2]); } else if (parts.length == 1) { // Run single rate start_rate = Integer.parseInt(parts[0]); end_rate = start_rate; rate_step = start_rate; } else { throw new org.apache.commons.cli.ParseException( "Rate must be three comma seperated values or a single value"); } } catch (org.apache.commons.cli.ParseException e) { cmdInputErrorMsg += e.getMessage(); } catch (NumberFormatException e) { cmdInputErrorMsg += "Invalid value for r. Must be integers.\n"; } } if (!cmdInputErrorMsg.equalsIgnoreCase("")) { throw new org.apache.commons.cli.ParseException(cmdInputErrorMsg); } // Assuming the ES port is 9220 RunTcpInBdsOutTest t = new RunTcpInBdsOutTest(); DecimalFormat df = new DecimalFormat("##0"); if (start_rate == end_rate) { // Single Rate Test System.out.println("*********************************"); System.out.println("Incremental testing at requested rate: " + start_rate); System.out.println("Count,Incremental Rate"); t.runTest(numberEvents, start_rate, gisServer, inputTcpPort, EventsInputFile, msLayerUrl, true); if (t.send_rate < 0 || t.rcv_rate < 0) { throw new Exception("Test Run Failed!"); } System.out.println("Overall Average Send Rate, Received Rate"); System.out.println(df.format(t.send_rate) + "," + df.format(t.rcv_rate)); } else { System.out.println("*********************************"); System.out.println("rateRqstd,avgSendRate,avgRcvdRate"); for (int rate = start_rate; rate <= end_rate; rate += rate_step) { t.runTest(numberEvents, rate, gisServer, inputTcpPort, EventsInputFile, msLayerUrl, false); if (t.send_rate < 0 || t.rcv_rate < 0) { throw new Exception("Test Run Failed!"); } System.out.println( Integer.toString(rate) + "," + df.format(t.send_rate) + "," + df.format(t.rcv_rate)); Thread.sleep(3 * 1000); } } } catch (ParseException e) { System.out.println("Invalid Command Options: "); System.out.println(e.getMessage()); System.out.println( "Command line options: -n NumberOfEvents -g GISServer -i InputTCPPort -m MapServerLayerURL -f FileWithEvents -r StartRate,EndRate,Step"); } catch (Exception e) { System.out.println(e.getMessage()); } }
From source file:net.bobah.mail.Dupes.java
public static void main(String[] args) throws Exception { installDefaultUncaughtExceptionHandler(log); final CommandLineParser parser = new PosixParser(); final Options options = new Options() .addOption("j", "threads", true, "number of parallel threads to use for analyzing") .addOption("hash", true, "hash function to use, possible values: " + Arrays.toString(Hashes.values())) .addOption("dir", true, "add directory to search"); final CommandLine cmdline = parser.parse(options, args); final int threads = Integer.valueOf( cmdline.getOptionValue("threads", String.valueOf(Runtime.getRuntime().availableProcessors()))); final HashFunction hash = Hashes.valueOf(cmdline.getOptionValue("hash", "adler32")).hashfunc; final File[] dirs = Collections2 .transform(Arrays.asList(cmdline.getOptionValues("dir")), new Function<String, File>() { @Override/*from www . j a v a 2s.co m*/ public File apply(String from) { return new File(from); } }).toArray(new File[] {}); log.info("hash: {}, threads: {}, dirs: {} in total", hash, threads, dirs.length); try { new Dupes(threads, hash, dirs).run(); } finally { Utils.shutdownLogger(); } }
From source file:ColumnStorage.TestColumnStorage.java
public static void main(String[] argv) throws Exception { try {// www . ja v a 2 s . co m if (argv.length < 1) { System.out.println("TestColumnStorage cmd[write | read ]"); return; } String cmd = argv[0]; if (cmd.equals("write")) { writeFile1(); writeFile2(); writeFile3(); } else { if (argv.length < 2) { System.out.println("TestColumnStorage read line"); return; } fieldMap.addField(new Field(ConstVar.FieldType_Byte, ConstVar.Sizeof_Byte, (short) 0)); fieldMap.addField(new Field(ConstVar.FieldType_Short, ConstVar.Sizeof_Short, (short) 1)); fieldMap.addField(new Field(ConstVar.FieldType_Int, ConstVar.Sizeof_Int, (short) 2)); fieldMap.addField(new Field(ConstVar.FieldType_Long, ConstVar.Sizeof_Long, (short) 3)); fieldMap.addField(new Field(ConstVar.FieldType_Float, ConstVar.Sizeof_Float, (short) 4)); fieldMap.addField(new Field(ConstVar.FieldType_Byte, ConstVar.Sizeof_Byte, (short) 5)); fieldMap.addField(new Field(ConstVar.FieldType_Short, ConstVar.Sizeof_Short, (short) 6)); fieldMap.addField(new Field(ConstVar.FieldType_Int, ConstVar.Sizeof_Int, (short) 7)); fieldMap.addField(new Field(ConstVar.FieldType_Long, ConstVar.Sizeof_Long, (short) 8)); fieldMap.addField(new Field(ConstVar.FieldType_Double, ConstVar.Sizeof_Double, (short) 9)); fieldMap.addField(new Field(ConstVar.FieldType_String, 0, (short) 10)); int line = Integer.valueOf(argv[1]); getRecordByLine1(line); } } catch (IOException e) { e.printStackTrace(); System.out.println("get IOException:" + e.getMessage()); } catch (Exception e) { e.printStackTrace(); System.out.println("get exception:" + e.getMessage()); } }
From source file:edu.msu.cme.rdp.kmer.cli.FastKmerFilter.java
public static void main(String[] args) throws Exception { final KmerSet<Set<RefKmer>> kmerSet; final SeqReader queryReader; final SequenceType querySeqType; final File queryFile; final KmerStartsWriter out; final boolean translQuery; final int wordSize; final int translTable; final boolean alignedSeqs; final List<String> refLabels = new ArrayList(); final int maxThreads; final int trieWordSize; try {//from ww w . j a va 2s.com CommandLine cmdLine = new PosixParser().parse(options, args); args = cmdLine.getArgs(); if (args.length < 3) { throw new Exception("Unexpected number of arguments"); } if (cmdLine.hasOption("out")) { out = new KmerStartsWriter(cmdLine.getOptionValue("out")); } else { out = new KmerStartsWriter(System.out); } if (cmdLine.hasOption("aligned")) { alignedSeqs = true; } else { alignedSeqs = false; } if (cmdLine.hasOption("transl-table")) { translTable = Integer.valueOf(cmdLine.getOptionValue("transl-table")); } else { translTable = 11; } if (cmdLine.hasOption("threads")) { maxThreads = Integer.valueOf(cmdLine.getOptionValue("threads")); } else { maxThreads = Runtime.getRuntime().availableProcessors(); } queryFile = new File(args[1]); wordSize = Integer.valueOf(args[0]); SequenceType refSeqType = null; querySeqType = SeqUtils.guessSequenceType(queryFile); queryReader = new SequenceReader(queryFile); if (querySeqType == SequenceType.Protein) { throw new Exception("Expected nucl query sequences"); } refSeqType = SeqUtils .guessSequenceType(new File(args[2].contains("=") ? args[2].split("=")[1] : args[2])); translQuery = refSeqType == SequenceType.Protein; if (translQuery && wordSize % 3 != 0) { throw new Exception("Word size must be a multiple of 3 for nucl ref seqs"); } if (translQuery) { trieWordSize = wordSize / 3; } else { trieWordSize = wordSize; } kmerSet = new KmerSet<Set<RefKmer>>();//new KmerTrie(trieWordSize, translQuery); for (int index = 2; index < args.length; index++) { String refName; String refFileName = args[index]; if (refFileName.contains("=")) { String[] lexemes = refFileName.split("="); refName = lexemes[0]; refFileName = lexemes[1]; } else { String tmpName = new File(refFileName).getName(); if (tmpName.contains(".")) { refName = tmpName.substring(0, tmpName.lastIndexOf(".")); } else { refName = tmpName; } } File refFile = new File(refFileName); if (refSeqType != SeqUtils.guessSequenceType(refFile)) { throw new Exception( "Reference file " + refFile + " contains " + SeqUtils.guessFileFormat(refFile) + " sequences but expected " + refSeqType + " sequences"); } SequenceReader seqReader = new SequenceReader(refFile); Sequence seq; while ((seq = seqReader.readNextSequence()) != null) { if (seq.getSeqName().startsWith("#")) { continue; } KmerGenerator kmers; try { if (translQuery) { //protein ref kmers = new ProtKmerGenerator(seq.getSeqString(), trieWordSize, alignedSeqs); } else { kmers = new NuclKmerGenerator(seq.getSeqString(), trieWordSize, alignedSeqs); } while (kmers.hasNext()) { Kmer temp = kmers.next(); long[] next = temp.getLongKmers(); Set<RefKmer> refKmers = kmerSet.get(next); if (refKmers == null) { refKmers = new HashSet(); kmerSet.add(next, refKmers); } RefKmer kmerRef = new RefKmer(); kmerRef.modelPos = kmers.getPosition(); kmerRef.refFileIndex = refLabels.size(); kmerRef.refSeqid = seq.getSeqName(); refKmers.add(kmerRef); } } catch (IllegalArgumentException ex) { //System.err.println(seq.getSeqName()+ " " + ex.getMessage()); } } seqReader.close(); refLabels.add(refName); } } catch (Exception e) { new HelpFormatter().printHelp( "KmerSearch <kmerSize> <query_file> [name=]<ref_file> ...\nkmerSize should be multiple of 3, (recommend 45, minimum 30, maximum 63) ", options); e.printStackTrace(); System.exit(1); throw new RuntimeException("Stupid jvm"); //While this will never get thrown it is required to make sure javac doesn't get confused about uninitialized variables } long startTime = System.currentTimeMillis(); long seqCount = 0; final int maxTasks = 25000; System.err.println("Starting kmer mapping at " + new Date()); System.err.println("* Number of threads: " + maxThreads); System.err.println("* References: " + refLabels); System.err.println("* Reads file: " + queryFile); System.err.println("* Kmer length: " + trieWordSize); System.err.println("* Kmer Refset Size: " + kmerSet.size()); final AtomicInteger processed = new AtomicInteger(); final AtomicInteger outstandingTasks = new AtomicInteger(); ExecutorService service = Executors.newFixedThreadPool(maxThreads); Sequence querySeq; while ((querySeq = queryReader.readNextSequence()) != null) { seqCount++; String seqString = querySeq.getSeqString(); if ((!translQuery && seqString.length() < wordSize) || (translQuery && seqString.length() < wordSize + 2)) { //System.err.println(querySeq.getSeqName() + "\t" + seqString.length()); continue; } final Sequence threadSeq = querySeq; Runnable r = new Runnable() { public void run() { try { processSeq(threadSeq, refLabels, kmerSet, out, wordSize, translQuery, translTable, false); processSeq(threadSeq, refLabels, kmerSet, out, wordSize, translQuery, translTable, true); processed.incrementAndGet(); outstandingTasks.decrementAndGet(); } catch (Exception e) { e.printStackTrace(); } } }; outstandingTasks.incrementAndGet(); service.submit(r); while (outstandingTasks.get() >= maxTasks) ; if ((processed.get() + 1) % 1000000 == 0) { System.err.println("Processed " + processed + " sequences in " + (System.currentTimeMillis() - startTime) + " ms"); } } service.shutdown(); service.awaitTermination(1, TimeUnit.DAYS); System.err.println("Finished Processed " + processed + " sequences in " + (System.currentTimeMillis() - startTime) + " ms"); out.close(); }
From source file:edu.msu.cme.rdp.graph.utils.ContigMerger.java
public static void main(String[] args) throws IOException { final BufferedReader hmmgsResultReader; final IndexedSeqReader nuclContigReader; final double minBits; final int minProtLength; final Options options = new Options(); final PrintStream out; final ProfileHMM hmm; final FastaWriter protSeqOut; final FastaWriter nuclSeqOut; final boolean prot; final boolean all; final String shortSampleName; options.addOption("a", "all", false, "Generate all combinations for multiple paths, instead of just the best"); options.addOption("b", "min-bits", true, "Minimum bits score"); options.addOption("l", "min-length", true, "Minimum length"); options.addOption("s", "short_samplename", true, "short sample name, to be used as part of contig identifiers. This allow analyzing contigs together from different samples in downstream analysis "); options.addOption("o", "out", true, "Write output to file instead of stdout"); try {/* w ww.j av a 2 s . c om*/ CommandLine line = new PosixParser().parse(options, args); if (line.hasOption("min-bits")) { minBits = Double.valueOf(line.getOptionValue("min-bits")); } else { minBits = Double.NEGATIVE_INFINITY; } if (line.hasOption("min-length")) { minProtLength = Integer.valueOf(line.getOptionValue("min-length")); } else { minProtLength = 0; } if (line.hasOption("short_samplename")) { shortSampleName = line.getOptionValue("short_samplename") + "_"; } else { shortSampleName = ""; } if (line.hasOption("out")) { out = new PrintStream(line.getOptionValue("out")); } else { out = System.err; } all = line.hasOption("all"); args = line.getArgs(); if (args.length != 3) { throw new Exception("Unexpected number of arguments"); } hmmgsResultReader = new BufferedReader(new FileReader(new File(args[1]))); nuclContigReader = new IndexedSeqReader(new File(args[2])); hmm = HMMER3bParser.readModel(new File(args[0])); prot = (hmm.getAlphabet() == SequenceType.Protein); if (prot) { protSeqOut = new FastaWriter(new File("prot_merged.fasta")); } else { protSeqOut = null; } nuclSeqOut = new FastaWriter(new File("nucl_merged.fasta")); } catch (Exception e) { new HelpFormatter().printHelp("USAGE: ContigMerger [options] <hmm> <hmmgs_file> <nucl_contig>", options); System.err.println("Error: " + e.getMessage()); System.exit(1); throw new RuntimeException("I hate you javac"); } String line; SearchDirection lastDir = SearchDirection.left; //So this has an assumption built in //It depends on hmmgs always outputting left fragments, then right //We can't just use the kmer to figure out if we've switched to another starting point //because we allow multiple starting model pos, so two different starting //positions can have the same starting kmer Map<String, Sequence> leftContigs = new HashMap(); Map<String, Sequence> rightContigs = new HashMap(); int contigsMerged = 0; int writtenMerges = 0; long startTime = System.currentTimeMillis(); String kmer = null; String geneName = null; while ((line = hmmgsResultReader.readLine()) != null) { if (line.startsWith("#")) { continue; } String[] lexemes = line.trim().split("\t"); if (lexemes.length != 12 || lexemes[0].equals("-")) { System.err.println("Skipping line: " + line); continue; } //contig_53493 nirk 1500:6:35:16409:3561/1 ADV15048 tcggcgctctacacgttcctgcagcccggg 40 210 70 left -44.692 184 0 int index = 0; String seqid = lexemes[0]; geneName = lexemes[1]; String readid = lexemes[2]; String refid = lexemes[3]; kmer = lexemes[4]; int modelStart = Integer.valueOf(lexemes[5]); int nuclLength = Integer.valueOf(lexemes[6]); int protLength = Integer.valueOf(lexemes[7]); SearchDirection dir = SearchDirection.valueOf(lexemes[8]); if (dir != lastDir) { if (dir == SearchDirection.left) { List<MergedContig> mergedContigs = all ? mergeAllContigs(leftContigs, rightContigs, kmer, geneName, hmm) : mergeContigs(leftContigs, rightContigs, kmer, geneName, hmm); contigsMerged++; for (MergedContig mc : mergedContigs) { String mergedId = shortSampleName + geneName + "_" + mc.leftContig + "_" + mc.rightContig; out.println(mergedId + "\t" + mc.length + "\t" + mc.score); if (mc.score > minBits && mc.length > minProtLength) { if (prot) { protSeqOut.writeSeq(mergedId, mc.protSeq); } nuclSeqOut.writeSeq(mergedId, mc.nuclSeq); writtenMerges++; } } leftContigs.clear(); rightContigs.clear(); } lastDir = dir; } Sequence seq = nuclContigReader.readSeq(seqid); if (dir == SearchDirection.left) { leftContigs.put(seqid, seq); } else if (dir == SearchDirection.right) { rightContigs.put(seqid, seq); } else { throw new IOException("Cannot handle search direction " + dir); } } if (!leftContigs.isEmpty() || !rightContigs.isEmpty()) { List<MergedContig> mergedContigs = all ? mergeAllContigs(leftContigs, rightContigs, kmer, geneName, hmm) : mergeContigs(leftContigs, rightContigs, kmer, geneName, hmm); for (MergedContig mc : mergedContigs) { String mergedId = shortSampleName + mc.gene + "_" + mc.leftContig + "_" + mc.rightContig; out.println(mergedId + "\t" + mc.length + "\t" + mc.score); contigsMerged++; if (mc.score > minBits && mc.length > minProtLength) { if (prot) { protSeqOut.writeSeq(mergedId, mc.protSeq); } nuclSeqOut.writeSeq(mergedId, mc.nuclSeq); writtenMerges++; } } } out.close(); if (prot) { protSeqOut.close(); } nuclSeqOut.close(); System.err.println("Read in " + contigsMerged + " contigs, wrote out " + writtenMerges + " merged contigs in " + ((double) (System.currentTimeMillis() - startTime) / 1000) + "s"); }
From source file:org.apache.commons.vfs2.util.NHttpServer.java
public static void main(final String[] args) throws Exception { new NHttpServer().run(Integer.valueOf(args[0]), new File(args[1]), 0); }
From source file:com.abiquo.vsm.migration.Migrator.java
public static void main(String[] args) throws UnknownHostException, IOException { String host = getProperty("abiquo.redis.host", "localhost"); int port = Integer.valueOf(getProperty("abiquo.redis.port", "6379")); CommandLine command = null;//from w w w . j av a 2 s .co m String filename = null; try { // Parse the command line arguments command = new PosixParser().parse(buildOptions(), args); if (command.hasOption("help")) { printUsage(); System.exit(0); } if (command.hasOption("f")) { filename = command.getOptionValue("f"); } if (command.hasOption("h")) { host = command.getOptionValue("h"); } if (command.hasOption("p")) { port = Integer.parseInt(command.getOptionValue("p")); } } catch (Exception e) { logger.error("Error while parsing arguments. " + e.getMessage()); printUsage(); System.exit(-1); } // Start migration Migrator migrator = new Migrator(host, port, 0); logger.info("Migrating from 1.6.8 to 1.7 data model on redis located at {}:{}", host, port); if (filename == null) { migrator.migrateNonPersistedModelFromRedis(); } else { File file = new File(filename); migrator.migrateNonPersistedModelFromFile(file); } migrator.migratePersistedModel(); logger.info("Number of migrated physical machines: {}", migrator.getMachinesCount()); logger.info("Number of migrated subscriptions: {}", migrator.getSubscriptionsCount()); System.exit(0); }
From source file:com.seanmadden.fast.ldap.main.Main.java
/** * The Main Event./*from w w w. j av a 2 s. c om*/ * * @param args */ @SuppressWarnings("static-access") public static void main(String[] args) { BasicConfigurator.configure(); log.debug("System initializing"); try { Logger.getRootLogger().addAppender( new FileAppender(new PatternLayout(PatternLayout.TTCC_CONVERSION_PATTERN), "log.log")); } catch (IOException e1) { log.error("Unable to open the log file..?"); } /* * Initialize the configuration engine. */ XMLConfiguration config = new XMLConfiguration(); config.setListDelimiter('|'); /* * Initialize the Command-Line parsing engine. */ CommandLineParser parser = new PosixParser(); Options opts = new Options(); opts.addOption(OptionBuilder.withLongOpt("config-file").hasArg() .withDescription("The configuration file to load").withArgName("config.xml").create("c")); opts.addOption(OptionBuilder.withLongOpt("profile").hasArg().withDescription("The profile to use") .withArgName("Default").create("p")); opts.addOption(OptionBuilder.withLongOpt("password").hasArg().withDescription("Password to connect with") .withArgName("password").create("P")); opts.addOption(OptionBuilder.withLongOpt("debug").hasArg(false).create('d')); opts.addOption(OptionBuilder.withLongOpt("verbose").hasArg(false).create('v')); File configurationFile = new File("config.xml"); try { // Parse the command-line options CommandLine cmds = parser.parse(opts, args); if (!cmds.hasOption('p')) { Logger.getRootLogger().addAppender(new GuiErrorAlerter(Level.ERROR)); } Logger.getRootLogger().setLevel(Level.ERROR); if (cmds.hasOption('v')) { Logger.getRootLogger().setLevel(Level.INFO); } if (cmds.hasOption('d')) { Logger.getRootLogger().setLevel(Level.DEBUG); } log.debug("Enabling configuration file parsing"); // The user has given us a file to parse. if (cmds.hasOption("c")) { configurationFile = new File(cmds.getOptionValue("c")); } log.debug("Config file: " + configurationFile); // Load the configuration file if (configurationFile.exists()) { config.load(configurationFile); } else { log.error("Cannot find config file"); } /* * Convert the profiles into memory */ Vector<ConnectionProfile> profs = new Vector<ConnectionProfile>(); List<?> profList = config.configurationAt("Profiles").configurationsAt("Profile"); for (Object p : profList) { SubnodeConfiguration profile = (SubnodeConfiguration) p; String name = profile.getString("[@name]"); String auth = profile.getString("LdapAuthString"); String server = profile.getString("LdapServerString"); String group = profile.getString("LdapGroupsLocation"); ConnectionProfile prof = new ConnectionProfile(name, server, auth, group); profs.add(prof); } ConnectionProfile prof = null; if (!cmds.hasOption('p')) { /* * Deploy the profile selector, to select a profile */ ProfileSelector profSel = new ProfileSelector(profs); prof = profSel.getSelection(); if (prof == null) { return; } /* * Empty the profiles and load a clean copy - then save it back * to the file */ config.clearTree("Profiles"); for (ConnectionProfile p : profSel.getProfiles()) { config.addProperty("Profiles.Profile(-1)[@name]", p.getName()); config.addProperty("Profiles.Profile.LdapAuthString", p.getLdapAuthString()); config.addProperty("Profiles.Profile.LdapServerString", p.getLdapServerString()); config.addProperty("Profiles.Profile.LdapGroupsLocation", p.getLdapGroupsString()); } config.save(configurationFile); } else { for (ConnectionProfile p : profs) { if (p.getName().equals(cmds.getOptionValue('p'))) { prof = p; break; } } } log.info("User selected " + prof); String password = ""; if (cmds.hasOption('P')) { password = cmds.getOptionValue('P'); } else { password = PasswordPrompter.promptForPassword("Password?"); } if (password.equals("")) { return; } LdapInterface ldap = new LdapInterface(prof.getLdapServerString(), prof.getLdapAuthString(), prof.getLdapGroupsString(), password); /* * Gather options information from the configuration engine for the * specified report. */ Hashtable<String, Hashtable<String, ReportOption>> reportDataStructure = new Hashtable<String, Hashtable<String, ReportOption>>(); List<?> repConfig = config.configurationAt("Reports").configurationsAt("Report"); for (Object p : repConfig) { SubnodeConfiguration repNode = (SubnodeConfiguration) p; // TODO Do something with the report profile. // Allowing the user to deploy "profiles" is a nice feature // String profile = repNode.getString("[@profile]"); String reportName = repNode.getString("[@report]"); Hashtable<String, ReportOption> reportOptions = new Hashtable<String, ReportOption>(); reportDataStructure.put(reportName, reportOptions); // Loop through the options and add each to the table. for (Object o : repNode.configurationsAt("option")) { SubnodeConfiguration option = (SubnodeConfiguration) o; String name = option.getString("[@name]"); String type = option.getString("[@type]"); String value = option.getString("[@value]"); ReportOption ro = new ReportOption(); ro.setName(name); if (type.toLowerCase().equals("boolean")) { ro.setBoolValue(Boolean.parseBoolean(value)); } else if (type.toLowerCase().equals("integer")) { ro.setIntValue(Integer.valueOf(value)); } else { // Assume a string type here then. ro.setStrValue(value); } reportOptions.put(name, ro); log.debug(ro); } } System.out.println(reportDataStructure); /* * At this point, we now need to deploy the reports window to have * the user pick a report and select some happy options to allow * that report to work. Let's go. */ /* * Deploy the Reports selector, to select a report */ Reports.getInstance().setLdapConnection(ldap); ReportsWindow reports = new ReportsWindow(Reports.getInstance().getAllReports(), reportDataStructure); Report report = reports.getSelection(); if (report == null) { return; } /* * Empty the profiles and load a clean copy - then save it back to * the file */ config.clearTree("Reports"); for (Report r : Reports.getInstance().getAllReports()) { config.addProperty("Reports.Report(-1)[@report]", r.getClass().getCanonicalName()); config.addProperty("Reports.Report[@name]", "Standard"); for (ReportOption ro : r.getOptions().values()) { config.addProperty("Reports.Report.option(-1)[@name]", ro.getName()); config.addProperty("Reports.Report.option[@type]", ro.getType()); config.addProperty("Reports.Report.option[@value]", ro.getStrValue()); } } config.save(configurationFile); ProgressBar bar = new ProgressBar(); bar.start(); report.execute(); ASCIIFormatter format = new ASCIIFormatter(); ReportResult res = report.getResult(); format.format(res, new File(res.getForName() + "_" + res.getReportName() + ".txt")); bar.stop(); JOptionPane.showMessageDialog(null, "The report is at " + res.getForName() + "_" + res.getReportName() + ".txt", "Success", JOptionPane.INFORMATION_MESSAGE); } catch (ParseException e) { HelpFormatter formatter = new HelpFormatter(); formatter.printHelp("FAST Ldap Searcher", opts); } catch (ConfigurationException e) { e.printStackTrace(); log.fatal("OH EM GEES! Configuration errors."); } catch (Exception e) { e.printStackTrace(); } }
From source file:com.ning.hfind.Find.java
public static void main(String[] origArgs) throws ParseException, IOException { PrinterConfig printerConfig = new PrinterConfig(); CommandLineParser parser = new PosixParser(); CommandLine line = parser.parse(options, origArgs); String[] args = line.getArgs(); if (args.length > 1) { // find(1) seems to complain about the first argument only, let's do the same System.out.println(String.format("hfind: %s: unknown option", args[1])); System.exit(COMMAND_LINE_ERROR); }//from w w w . j a va 2 s .c om if (line.hasOption("help") || args.length == 0) { usage(); return; } String path = args[0]; // Optimization: check the depth on a top-level basis, not on a per-file basis // This avoids crawling files on Hadoop we don't care about int maxDepth = Integer.MAX_VALUE; if (line.hasOption("maxdepth")) { String maxDepthOptionValue = line.getOptionValue("maxdepth"); maxDepth = Integer.valueOf(maxDepthOptionValue); } if (line.hasOption("delete")) { // -delete implies -d printerConfig.setDepthMode(true); printerConfig.setDeleteMode(true); } if (line.hasOption("d")) { printerConfig.setDepthMode(true); } if (line.hasOption("print0")) { printerConfig.setEndLineWithNull(true); } if (line.hasOption("verbose")) { printerConfig.setVerbose(true); } // Ignore certain primaries Iterator<Option> optionsIterator = ExpressionFactory.sanitizeCommandLine(line.getOptions()); Expression expression = null; try { expression = ExpressionFactory .buildExpressionFromCommandLine(new PushbackIterator<Option>(optionsIterator)); //System.out.println(String.format("find %s: %s", StringUtils.join(origArgs, " "), expression)); } catch (IllegalArgumentException e) { System.err.println(e); System.exit(COMMAND_LINE_ERROR); } try { expression.run(path, maxDepth, printerConfig); System.exit(0); } catch (IOException e) { System.err.println(String.format("Error crawling HDFS: %s", e.getLocalizedMessage())); System.exit(HADOOP_ERROR); } }
From source file:com.bitsofproof.example.Simple.java
public static void main(String[] args) { Security.addProvider(new BouncyCastleProvider()); final CommandLineParser parser = new GnuParser(); final Options gnuOptions = new Options(); gnuOptions.addOption("h", "help", false, "I can't help you yet"); gnuOptions.addOption("s", "server", true, "Server URL"); gnuOptions.addOption("u", "user", true, "User"); gnuOptions.addOption("p", "password", true, "Password"); System.out.println("BOP Bitcoin Server Simple Client 3.5.0 (c) 2013-2014 bits of proof zrt."); CommandLine cl = null;//www . j a va 2 s . co m String url = null; String user = null; String password = null; try { cl = parser.parse(gnuOptions, args); url = cl.getOptionValue('s'); user = cl.getOptionValue('u'); password = cl.getOptionValue('p'); } catch (org.apache.commons.cli.ParseException e) { e.printStackTrace(); System.exit(1); } if (url == null || user == null || password == null) { System.err.println("Need -s server -u user -p password"); System.exit(1); } BCSAPI api = getServer(url, user, password); try { BufferedReader input = new BufferedReader(new InputStreamReader(System.in)); long start = System.currentTimeMillis(); api.ping(start); System.out.println("Server round trip " + (System.currentTimeMillis() - start) + "ms"); api.addAlertListener(new AlertListener() { @Override public void alert(String s, int severity) { System.err.println("ALERT: " + s); } }); System.out.println("Talking to " + (api.isProduction() ? "PRODUCTION" : "test") + " server"); ConfirmationManager confirmationManager = new ConfirmationManager(); confirmationManager.init(api, 144); System.out.printf("Please enter wallet name: "); String wallet = input.readLine(); SimpleFileWallet w = new SimpleFileWallet(wallet + ".wallet"); TransactionFactory am = null; if (!w.exists()) { System.out.printf("Enter passphrase: "); String passphrase = input.readLine(); System.out.printf("Enter master (empty for new): "); String master = input.readLine(); if (master.equals("")) { w.init(passphrase); w.unlock(passphrase); System.out.printf("First account: "); String account = input.readLine(); am = w.createAccountManager(account); w.lock(); w.persist(); } else { StringTokenizer tokenizer = new StringTokenizer(master, "@"); String key = tokenizer.nextToken(); long since = 0; if (tokenizer.hasMoreElements()) { since = Long.parseLong(tokenizer.nextToken()) * 1000; } w.init(passphrase, ExtendedKey.parse(key), true, since); w.unlock(passphrase); System.out.printf("First account: "); String account = input.readLine(); am = w.createAccountManager(account); w.lock(); w.persist(); w.sync(api); } } else { w = SimpleFileWallet.read(wallet + ".wallet"); w.sync(api); List<String> names = w.getAccountNames(); System.out.println("Accounts:"); System.out.println("---------"); String first = null; for (String name : names) { System.out.println(name); if (first == null) { first = name; } } System.out.println("---------"); am = w.getAccountManager(first); System.out.println("Using account " + first); } confirmationManager.addAccount(am); api.registerTransactionListener(am); while (true) { printMenu(); String answer = input.readLine(); System.out.printf("\n"); if (answer.equals("1")) { System.out.printf("The balance is: " + printBit(am.getBalance()) + "\n"); System.out.printf(" confirmed: " + printBit(am.getConfirmed()) + "\n"); System.out.printf(" receiveing: " + printBit(am.getReceiving()) + "\n"); System.out.printf(" change: " + printBit(am.getChange()) + "\n"); System.out.printf("( sending: " + printBit(am.getSending()) + ")\n"); } else if (answer.equals("2")) { for (Address a : am.getAddresses()) { System.out.printf(a + "\n"); } } else if (answer.equals("3")) { ExtendedKeyAccountManager im = (ExtendedKeyAccountManager) am; System.out.printf( im.getMaster().serialize(api.isProduction()) + "@" + im.getCreated() / 1000 + "\n"); } else if (answer.equals("4")) { System.out.printf("Enter passphrase: "); String passphrase = input.readLine(); w.unlock(passphrase); ExtendedKeyAccountManager im = (ExtendedKeyAccountManager) am; System.out.printf( im.getMaster().serialize(api.isProduction()) + "@" + im.getCreated() / 1000 + "\n"); w.lock(); } else if (answer.equals("5")) { System.out.printf("Enter passphrase: "); String passphrase = input.readLine(); w.unlock(passphrase); System.out.printf("Number of recipients"); Integer nr = Integer.valueOf(input.readLine()); Transaction spend; if (nr.intValue() == 1) { System.out.printf("Receiver address: "); String address = input.readLine(); System.out.printf("amount (Bit): "); long amount = parseBit(input.readLine()); spend = am.pay(Address.fromSatoshiStyle(address), amount); System.out.println("About to send " + printBit(amount) + " to " + address); } else { List<Address> addresses = new ArrayList<>(); List<Long> amounts = new ArrayList<>(); long total = 0; for (int i = 0; i < nr; ++i) { System.out.printf("Receiver address: "); String address = input.readLine(); addresses.add(Address.fromSatoshiStyle(address)); System.out.printf("amount (Bit): "); long amount = parseBit(input.readLine()); amounts.add(amount); total += amount; } spend = am.pay(addresses, amounts); System.out.println("About to send " + printBit(total)); } System.out.println("inputs"); for (TransactionInput in : spend.getInputs()) { System.out.println(in.getSourceHash() + " " + in.getIx()); } System.out.println("outputs"); for (TransactionOutput out : spend.getOutputs()) { System.out.println(out.getOutputAddress() + " " + printBit(out.getValue())); } w.lock(); System.out.printf("Type yes to go: "); if (input.readLine().equals("yes")) { api.sendTransaction(spend); System.out.printf("Sent transaction: " + spend.getHash()); } else { System.out.printf("Nothing happened."); } } else if (answer.equals("6")) { System.out.printf("Address: "); Set<Address> match = new HashSet<Address>(); match.add(Address.fromSatoshiStyle(input.readLine())); api.scanTransactionsForAddresses(match, 0, new TransactionListener() { @Override public boolean process(Transaction t) { System.out.printf("Found transaction: " + t.getHash() + "\n"); return true; } }); } else if (answer.equals("7")) { System.out.printf("Public key: "); ExtendedKey ek = ExtendedKey.parse(input.readLine()); api.scanTransactions(ek, 0, 10, 0, new TransactionListener() { @Override public boolean process(Transaction t) { System.out.printf("Found transaction: " + t.getHash() + "\n"); return true; } }); } else if (answer.equals("a")) { System.out.printf("Enter account name: "); String account = input.readLine(); am = w.getAccountManager(account); api.registerTransactionListener(am); confirmationManager.addAccount(am); } else if (answer.equals("c")) { System.out.printf("Enter account name: "); String account = input.readLine(); System.out.printf("Enter passphrase: "); String passphrase = input.readLine(); w.unlock(passphrase); am = w.createAccountManager(account); System.out.println("using account: " + account); w.lock(); w.persist(); api.registerTransactionListener(am); confirmationManager.addAccount(am); } else if (answer.equals("m")) { System.out.printf("Enter passphrase: "); String passphrase = input.readLine(); w.unlock(passphrase); System.out.println(w.getMaster().serialize(api.isProduction())); System.out.println(w.getMaster().getReadOnly().serialize(true)); w.lock(); } else if (answer.equals("s")) { System.out.printf("Enter private key: "); String key = input.readLine(); ECKeyPair k = ECKeyPair.parseWIF(key); KeyListAccountManager alm = new KeyListAccountManager(); alm.addKey(k); alm.syncHistory(api); Address a = am.getNextReceiverAddress(); Transaction t = alm.pay(a, alm.getBalance(), PaymentOptions.receiverPaysFee); System.out.println("About to sweep " + printBit(alm.getBalance()) + " to " + a); System.out.println("inputs"); for (TransactionInput in : t.getInputs()) { System.out.println(in.getSourceHash() + " " + in.getIx()); } System.out.println("outputs"); for (TransactionOutput out : t.getOutputs()) { System.out.println(out.getOutputAddress() + " " + printBit(out.getValue())); } System.out.printf("Type yes to go: "); if (input.readLine().equals("yes")) { api.sendTransaction(t); System.out.printf("Sent transaction: " + t.getHash()); } else { System.out.printf("Nothing happened."); } } else { System.exit(0); } } } catch (Exception e) { System.err.println("Something went wrong"); e.printStackTrace(); System.exit(1); } }